Investigation of the Apoptotic Effect of Levofloxacin on Ovarian Follicles of NMRI Mice and its Anticancer Effect on Human Ovarian Cancer Cell Line

Background: Levofloxacin is a fluoroquinolone antibiotic with extensive anti-bacterial effects.
Objectives: This research surveyed the cytotoxicity effects of levofloxacin on ovarian follicles of mice in both in vitro and in vivo conditions, as well as its anticancer effect on human ovarian cancer cell line (SKOV3).
Methods: For in vitro study, the ovaries of animals were isolated and treated with levofloxacin at doses of 1, 2, 5, and 10 µg/ml for 6 days. For in vivo study, animals were treated with levofloxacin at concentrations of 100, 200, 400, and 800 mg/kg for 24 days. Histopathological and morphological examinations of ovarian tissues were performed. Real-time PCR and Western Blot techniques were performed to analyze apoptosis-related genes and proteins of ovarian tissues. 
Results: Levofloxacin at higher concentrations caused morphological changes and remarkably decreased the number of primary, secondary, and adult follicles compared to the control group. The percentage of viable SKOV3 cells was 10.12%, 7.63%, and 2.17% following exposure to levofloxacin (at a concentration of 800 μg/ml) for 24, 48, and 72 h, respectively. The half-maximal inhibitory concentration of levofloxacin against SKOV3 was found to be 181.1, 74.84, and 27.58 μg/ml at 24, 48, and 72 h, respectively. The percentage of SKOV3 cells apoptosis following exposure to levofloxacin after 72 h at 20, 80, and 200 μg/ml doses was 11%, 42%, and 52%, respectively. Real-time PCR revealed up-regulation of Bax and Caspase-3 genes after exposure to levofloxacin in SKOV3 cells, whereas the expression of Bcl2 was significantly decreased in a concentration-depended manner. 
Conclusion: The present study demonstrates that levofloxacin induces apoptosis of both ovarian follicles and human ovarian cancer cell lines.

Keywords:Apoptosis, Bax, Bcl2, Caspase-3, Levofloxacin, Ovary, Ovarian cancer

Antibiotics have been widely used to prevent bacterial infections in humans and animals (1). However, repeated antibiotic use may be associated with severe adverse effects. Consequently, it is necessary to explore their short and long-lasting side effects in clinical applications. Levofloxacin is a member of fluoroquinolone antibiotic that treats many types of bacterial pathogens in the genitourinary system and lower respiratory tract (2, 3). Studies revealed that levofloxacin acts against a wide range of gram-positive and -negative bacteria by inhibiting DNA Gyrase (topoisomerase II and IV) function and preventing DNA supercoiling (4, 5). In addition, some studies demonstrated that levofloxacin has a strong anticancer effect against different cancer types such as lung cancer cells (6), genitourinary cancer (7), bladder cancer (7), and acute myeloid leukemia (8). It has been shown that levofloxacin remarkably enhances apoptosis and decreases cancer cell formation by inducing cell cycle arrest (5, 9, 10). More recently, Kloskowski et al. (7) have demonstrated that levofloxacin caused an increase in late apoptotic cells and an inhibition of bladder and prostate cancer cell cycle at the S phase.
Furthermore, it led to cancer cell apoptosis by inducing the expression of Bax in cancer cells (7). These data indicate that levofloxacin not only has an anti-bacterial effect but also promotes cancer cell apoptosis (11). For this reason, it is a suitable candidate for cancer therapy; however, its use should be monitored carefully as its long-term consumption may be associated with some adverse effects (3, 12). Therefore, further in-depth studies are essential to explore its adverse effects on different organs. 
The mammalian ovary is a dynamic organ and a rich source of multiple hormones and growth factors that nurture and prepare oocytes for the process of ovulation (13). Identification of risk factors associated with ovarian dysfunction is vital. Recent evidence has reported that levofloxacin use may destroy the structure and function of ovary tissue by affecting the production of follicle-stimulating and luteinizing hormones and progesterone (14).

These data emphasize that ovarian tissue may be a target for levofloxacin so that this antibiotic can be used to treat ovarian cancer; however, little information is available regarding the effects of levofloxacin and its underlying mechanisms on ovary tissue. Given that ovary structure can be affected by levofloxacin, we pointed to assess its effects on apoptosis of ovarian normal and cancer cell lines in both in vivo and in vitro models.

3.1. Animals
A total of 66 female NMRI mice (age:6-8 weeks, body weight: 25-30 g) were purchased from the animal lab of Qom Islamic Azad University (Qom, Iran). All experiments were conducted following the ethical guideline of animal studies approved by the ethical committee of Qom Islamic Azad University (IR.IAU.SRB.REC.1398.012). After adaptation to the lab conditions (temperature of 22± 2 °C, humidity 50%±5%, and a 12 light/dark cycle), mice were randomly split up into two experimental groups (in vivo and in vitro groups), containing 36 mice, 6 per cage (30×15×15 cm) with free access to food and water.

3.2. Treatments
For in vivo study, 36 female mice were divided into 6 groups, including control, sham (received standard pellet/water), and four other groups were fed with various doses of levofloxacin (100 mg/kg, 200 mg/kg, 400 mg/kg, and 800 mg/kg) solution (Sigma Aldrich, USA). All the treatments were performed for a period of 4 weeks. One day after the last treatment, mice were anesthetized with chloroform, and ovarian tissues were removed for histopathological examination and gene expression analysis.
For in vitro study, 30 female mice were anesthetized with chloroform, and ovarian tissues were removed and cultured in DMEM/F-12 (Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12) supplemented with 10% FBS, BSA (3 mg/ml), 0.23 mM pyruvic acid, and 1% penicillin-streptomycin with pH 7.4. Cultured ovarian tissues were incubated at 37 ± 0.5 oC with 5% CO2 for 6 days. During this period, the cultured ovarian tissues were divided into 6 groups, including control (without treatment), ovarian tissues treated with 1 μg/ml, 2 μg/ml, 5 μg/ml, and 10 μg/ml levofloxacin solution every day for 6 days. At the end of the study, cultured ovarian tissues were evaluated for gene expression analysis and histopathological examination. Levofloxacin concentrations for both in vivo and in vitro studies were selected based on LD50 and the cytotoxicity effect of levofloxacin described by previous studies (2, 6, 15-17). 

3.3. Histological examinations
To find histological alterations, ovarian samples were fixed in Bouin solution for 5-6 h. After dehydration and paraffinization, 5 μm sections were prepared using an automatic microtome, stained (H&E), and a light microscope was applied for histological assessment. 

3.4. Gene expression analysis
Total RNA of ovarian samples was extracted using the GeneAll Kit (). Briefly, 150 mg of ovarian specimens were homogenized and mixed with 400 μl lysis buffer and 10 μl 2-mercaptoethanol (2-ME) for 10 min. The mixture was then centrifuged at 11,000 rpm/4 °C for 1 min. The quantity and purity
of extracted RNAs were assessed with gel electrophoresis and a Nanodrop ND-1000 spectrophotometer (Thermo Sci., Newington, NH). The cDNA was synthesized using HyperScript TM RT premix kit (GeneAll) according to the manufacturer’s protocol. Around 10 μl HyperScript TM RT premix was mixed with 1 μg RNA and increased to the volume of 20 μl using distilled water. Moreover, cDNA was synthesized in a thermocycler as follows: 5 minutes at 25 °C, 55 minutes at 55 °C, and 5 minutes at 95 °C. Subsequently, 40 cycles of amplification were accomplished using SYBR Green-based real-time PCR. Each reaction included 10 μl master mix, 5 μM primers, 2 μl cDNA, and 2 μl of ddH2O. Forward and reverse primers are depicted in Table 1. Furthermore, GAPDH was adopted as a reference gene, and 2-ΔCt method was considered for the relative expression of studied genes.

 

Table 1. Primers sequence used for in vivo study of apoptosis-related genes
Genes		Sequence (5'->3')
Bax	Forward	TTCACAGGTTGGCATTAGG
	Reverse	TCAGCCCATCTTCTTCCAG
Bcl2	Forward	CCCTTCGGAGTTTAATCAGA
	Reverse	CCTTCTTCTCGGCAATTTAC
Caspase-3	Forward	CCTCAGAGAGACATTCATGG
	Reverse	GCAGTAGTCGCCTCTGAAGA
GAPDH	Forward	AAGGTCATCCCAGAGCTGAA
	Reverse	CTGCTTCACCACCTTCTTGA

 

3.5. Effect of levofloxacin on ovarian cancer cells viability
Normal ovarian cell line (GCN-01) and ovarian cancer cell line (SKOV3) were purchased from Pasteur Institute of Iran and cultured in DMEM (Sigma), enriched with FBS 10% and pen strep (100 mg/ml). Cells were grown at 37 oC, under a 5% CO2 atmosphere, and at 90% humidity for 24 h. The cytotoxic effects of levofloxacin against ovarian cancer and normal cells were assessed using the MTT test. Cell suspensions (104 cells) were loaded in a 96-well tissue culture plate and treated with various doses of levofloxacin (10, 20, 40, 80, 100, 200, 400, and 800 μg/ml) which were prepared in 1% dimethyl sulfoxide (DMSO) solution. The culture media was treated with different concentrations of levofloxacin for 24, 48, and 72 h. Cell viability was then assessed in a triplicate form for each concentration. In short, the supernatants were removed from the wells, and 20 μl of MTT solution was added to each plate. The plates were incubated for 4 h at 37 °C, and 100 μl of DMSO was added to the wells to dissolve the MTT crystals. The plates were then shaken for 15 min, and the absorbance was read at 570 nm. The percentage of cells viability was calculated using the following formula:
Cells viability = (OD treated cells/OD negative control) ×100

3.6. Effect of levofloxacin on ovarian cancer cells apoptosis
Flow Cytometry method using a fluorescein isothiocyanate annexin V (Annexin V-FITC Apoptosis Detection Kit, Roch, Germany) and propidium iodide (PI) was hired for apoptosis detection. The SKOV3 cells (2×106 cells/well) were treated with levofloxacin (20, 80, and 200 μg/ml) and incubated in 12-well plates at 37 °C with 5% CO2 for 72 h. Cells were then isolated from the plate using 0.25 M Trypsin-EDTA and centrifugation at 1500 ×g for 5 min. The cell pellets were treated with 5 mg/ml Annexin V and 6 mg/ml PI for 20 min in a dark place. FlowJo software (version 9) was adopted to determine the percentage of apoptotic cells.

3.7. Analysis of apoptotic genes expression in ovarian cancer cells
The SKOV3 cells (2×106 cells/well) were treated with levofloxacin at doses of 20, 80, and 200 μg/ml in 6-well plates in a Co2 incubator for 72 h to analyze apoptosis-related genes. Total RNAs were extracted using a nucleic acid extraction kit (Yekta Tajhiz Nika, Iran), and cDNA was synthesized using the One Step M-MULV RT-PCR Kit (Bio Basic, Canada). For cDNA synthesis, 5 μg RNA was mixed with 1 μl random hexamer, 6.5 μl cDNA Synthesis Mix and met a total extent of 20 μl using ddH2O. Subsequently, a SYBR green-based real-time PCR assay in 124 cycles was applied for amplification (1 cycle 5 min at 95 °C; 40 cycles 15 sec at 95 °C; 40 cycles 30 sec at 60 °C; 40 cycles 30 sec at 72 °C; 1 cycle 1 min at 95 °C; 1 cycle 1 min at 60 °C; 1 cycle 1 min at 95 °C). Each reaction contained 10 μl master mix, 2 μl primers (5 μM), and 2 μl cDNA to reach a total volume of 20 μl with ddH2O. Primer sequences are shown in Table 2. In addition, β-Actin was used as the reference gene, and 2-ΔCt method was used for the calculation of gene expressions.

3.8. Analysis of expression of apoptosis-related proteins in ovarian cancer cells
The Western Blot method was applied to analyze apoptosis-related proteins in ovarian cancer cells. The SKOV3 cells (2×106 cells/well) were exposed to different quantities of levofloxacin (20, 80, and 200 μg/ml) in 6-well plates and incubated at 37 °C with 5% CO2 for 3 days. Furthermore, proteins were extracted using RIPA buffer. The presence of proteins was analyzed using SDS-PAGE electrophoresis and then verified by the Western Blotting technique. Western Blotting (Bio-Rad, USA) was run at a constant 75 V voltage for 90 min. The PVDF sheet was blocked overnight with 3% BSA (Sigma, USA). Each primary monoclonal (BioLegend USA) and secondary polyclonal antibodies [IgG-HRP, (Sigma Aldrich, USA)] were applied for 60 min and washed out with PBS-Tween 20. DAB chromogen (Roch, German) was used for staining. Dot Blotting was carried out on diluted (1:20) samples with the same staining protocol as Western Blotting.

3.9. Statistical analysis
All experimental tests were carried out with three replicates. All quantitative data were reported as means ± SD. The one-way ANOVA test was selected to compare means on SPSS software (IBM, Version 20). A P-value < 0.05 was considered statistically significant.

 

4.1. Histopathological changes of levofloxacin in vitro
Histopathological examination of ovarian tissue showed no abnormalities in the no-treated group (Figure. 1A). Normal germinal epithelium was seen in the ovary. The thickness of tunica albuginea was normal. The ovarian parenchyma is composed of loose connective tissue, highly cellular, and numerous ovarian follicles. Follicles were observed in all stages, and primitive follicles were witnessed in both cortical and medullary regions. There were no degenerated oocytes and disrupted granulosa cells in the ovary. Additionally, there was no pyknotic nucleus in granulosa cells. The corpus luteum was not observed due to the short treatment time of ovaries with levofloxacin in a culture medium (6 days). No bleeding was seen in the ovaries (Figure 1A). Histopathological examination of ovarian tissue treated with 1 μg/ml levofloxacin showed a decrease in different forms of follicles compared with normal mice, and the most significant reduction was seen in mature follicles. The size of the theca and granulosa layers did not change (Figure 1B). Ovarian tissue treated with 2 μg/ml levofloxacin showed the highest reduction of primary follicles compared to other groups. While the decrease in the number of secondary follicles in this group was higher than in ovarian tissue treated with 1 μg/ml levofloxacin, the number of adult follicles was higher in this group. No changes were observed in the size of the theca and granulosa layers. Moreover, the blood vessels were seen scattered (Figure 1C). In ovarian tissue treated with 5 μg/ml levofloxacin, the number of primary follicles remained unchanged while secondary follicles were significantly reduced.
Additionally, mature follicles recognizably surged in comparison with mice treated with 2 μg/ml levofloxacin. The size of theca and granulosa layers showed no significant change (Figure. 1D). In ovarian tissue treated with 10 μg/ml levofloxacin, the follicular assembly was completely disrupted. In some cases, disrupted granulosa cells were seen. Blood vessels were increased along with the number of mature and primary follicles, while secondary follicles had decreased. The size of theca and granulosa layers did not change (Figure. 1E). 

Table 2. Primers sequence used for in vitro study of apoptotic genes
Genes		Sequence (5'->3')
Bax	Forward	TGCTTCAGGGTTTCATCCA
	Reverse	GACACTCGCTCAGCTTCTTG
Bcl2	Forward	TGTGGATGAGTGACTACCTGAACC
	Reverse	CAGCCAGGAGAAATCAAACAGAGG
Caspase-3	Forward	GGAAGCGAATCAATGGACTCTGG
	Reverse	GCATCGACATCTGTACCAGACC
Actin	Forward	AAGATCCTCACCCAGTGTGG
	Reverse	CAGCACTGTGTTGGTGTACAGG

 

 

 

4.2. Histological alterations by different doses of levofloxacin in vivo
A comparison of the histopathological examination of ovarian tissue in vivo condition is presented in Figure 2. The ovarian tissue of healthy mice had normal germinal epithelium. The thickness of tunica albuginea was normal, and the ovarian parenchyma had loose connective tissue with highly cellular and numerous ovarian follicles. Follicles were observed in all stages. Normal blood supply was observed, and the ovaries and primitive follicles were found in the ovarian cortex. Follicular assembly was normal; there were no degenerated oocytes and disrupted granulosa cells in the ovary. The corpus luteum was observed without bleeding in the ovaries (Figure. 2A). The ovarian tissue of rats treated with 100 mg/kg levofloxacin showed a decrease in the number of primary, secondary, and adult follicles compared to the control group. The corpus luteum and follicular atresia were observed in the ovary. The size of the theca and granulosa layers was minimally decreased. The ovarian parenchyma had loose connective tissue (Figure. 2B). In contrast to the normal figure of adult follicles, in mice treated with 200 mg/kg of levofloxacin, the number of primary and secondary follicles was noticeably decreased. While an increase was found in follicular atresia, a decrease was observed in the size of the theca and granulosa layers, as well as the number of corpus luteum (Figure. 2C). The ovarian tissue of animals treated with 400 mg/kg levofloxacin revealed a significant decrease in the number of primary, secondary, and mature follicles compared to those in control and received 200 mg/kg levofloxacin.
Follicular atresia was climbed dose-dependently; however, the number of corpus luteum was decreased. While no change was found in the size of the theca layer, the size of the granulosa layer was decreased (Figure. 2D). In mice that received 800 mg/kg of levofloxacin all types of follicles dramatically declined, contrary to the control group. Follicular assembly was completely disrupted, and disrupted granulosa cells were found in some animals. An increase was observed in blood vessels and follicular atresia. The number of corpus luteum and the size of the granulosa layer were significantly decreased (Figure. 2E).  

4.3. Quantitative analysis of morphological parameters following in vitro and in vivo exposure to levofloxacin
A comparison of the morphological parameters of ovarian tissue between different groups after in vitro and in vivo levofloxacin exposure is summarized in tables 2 and 3, respectively. Levofloxacin showed a significant effect on morphological parameters of ovarian tissue in a dose-depended manner. In vitro and in vivo exposures to levofloxacin significantly decreased all types of follicles in a dose-depended manner compared with the normal group. Furthermore, the thickness of theca and granulosa layers was significant following in vitro and in vivo exposure to levofloxacin, especially at higher concentrations. A significant decrease was observed in the number of corpus luteum following in vivo exposure to levofloxacin at concentrations of 200-800 mg/kg when opposed to the control group. On the other hand, in vivo exposure to levofloxacin caused a significant increase in follicular atresia at concentrations of 100-800 mg/kg compared to the control group (Table 2).  

4.4. Gene expression analysis
A marked difference was found in the expression figure of studied apoptotic genes, Bax, Bcl2, and Caspase-3, between groups (Figure. 3). Overall, in vitro exposure to levofloxacin caused a notable increase in Bax and Caspase-3 expression. However, a remarkable decrease in expression of Bcl2 genes when compared to the control group (Figure. 3A). Levofloxacin exposure at concentrations of 5μg/ml and 10μg/ml caused a sensational surge in the expression of Bax by 8.33-fold and 20-fold, respectively (Figure. 3A; P<0.001). Similarly, exposure to levofloxacin at concentrations of 5μg/ml and 10μg/ml caused upregulation of Caspase-3 by 9.33-fold and 16.33-fold, respectively (Figure. 3A; P<0.001). In contrast, a considerable drop was observed in the expression of Bcl2 by 1.5-fold and 3-fold at concentrations of 5μg/ml and 10μg/ml, respectively (Figure. 2A; P<0.001). Similarly, in vivo exposure to levofloxacin, especially at concentrations of 400 mg/kg and 800 mg/kg, led to a noticeable rise in Bax and Caspase-3 expression; however, dropped the expression of Bcl2 genes when compared to normal mice (Figure 3B). In vivo treatment with levofloxacin at concentrations of 5μg/ml and 10μg/ml caused a significant increase in expression of Bax by 4.08-fold and 7.8-fold, respectively (Fig. 3B; P<0.001). Additionally, a significant increase was observed in the expression of Caspase-3 by 4.61-fold and 6.64-fold following in vivo exposure to levofloxacin at concentrations of 5μg/ml and 10μg/ml, respectively (Fig. 3B; P<0.001). In contrast, a significant reduction was found in the expression of Bcl2 by 2.89-fold and 9.45-fold at concentrations of 5μg/ml and 10μg/ml, respectively (Fig. 3B; P<0.001). 

One-Way ANOVA: Post-hoc Tukey test was applied to compare mean value of parameters between all groups. *P<0.001; **P<0.01; ***P<0.05 compared to control group.

Table 3. Comparison of the mean of morphological parameters of ovarian tissue between different groups following in vitro levofloxacin exposure
	Control	1 μg/ml	2 μg/ml	5 μg/ml	10 μg/ml
Primary follicles (n)	15.92 ± 2.23	11.04 ± 2.14**	9.17 ± 2.33*	6.76 ± 2.65*	4.67 ± 2.03*
Secondary follicles (n)	18.48 ± 3.17	14.29 ± 2.95***	12.64 ± 2.57**	7.33 ± 1.89*	5.27 ± 2.86*
Mature follicles (n)	8.96 ± 1.77	5.32 ± 1.27**	4.79 ± 0.86*	3.02 ± 0.74*	2.13 ± 0.62*
Theca layer (μm)	25.02 ± 1.11	24.32 ± 0.79	20.02 ± 1.56**	20.06 ± 1.72**	15.03 ± 0.68*
Granulosa layer (μm)	49.08 ± 0.81	48.1 ± 0.72	47.69 ± 1.02	47.65 ± 0.94	41.02 ± 0.82*

 

 

4.5. Effect of levofloxacin on ovarian cancer cells viability
While levofloxacin showed no significant cytotoxicity effect on normal ovarian cells (GCN-01) at different times (Figure. 4A), it significantly decreased the percentage of ovarian cancer cells (SKOV3) in a dose-related manner (Figure. 4B). Levofloxacin exhibited poor anticancer activity at a concentration of 10 μg/ml, whereas it showed a strong anticancer effect at a concentration of 800 μg/ml. The percentage of SKOV3 cells was 10.12%, 7.63%, and 2.17% following exposure to a higher concentration of levofloxacin (800 μg/ml) after 24, 48, and 72 h, respectively (Figure. 4B). The IC50 value of levofloxacin against SKOV3 was found to be 181.1 μg/ml, 74.84 μg/ml, and 27.58 μg/ml at 24, 48, and 72 h, respectively (Figure. 4C).

4.6. Effect of levofloxacin on ovarian cancer cells apoptosis 
Annexin V-FITC test analysis showed that the percentage of SKOV3 cells apoptosis following exposure to levofloxacin after 72 h at concentrations of 20 μg/ml, 80 μg/ml, and 200 μg/ml was 11%, 42%, and 52%, respectively (Figure. 5A). The percentage of early and late apoptosis was considerably higher in levofloxacin-treated SKOV3 cells than healthy mice (Figure. 5B).
Real-time PCR test analysis revealed increased expression of Bax and Caspase-3 genes after exposure to levofloxacin in SKOV3 cells. In contrast, the expression of Bcl2 was significantly decreased in a concentration-depended manner (Figure. 6 A). Immunoblotting test results showed lower expression of Bcl2 following treatment with levofloxacin, whereas over-expression of Bax and Caspase-3 in SKOV3 cells in a dose-depended manner (Figure. 6B).

 

 

 

Given that levofloxacin antibiotic has been widely used for treating bacterial pathogens worldwide, this study assessed levofloxacin effects on ovarian tissue in both in vitro and in vivo models, as well as its impact on ovarian cancer cells apoptosis. Our findings revealed that levofloxacin administration destroys the structure of ovary tissue in a dose-depended manner in both in vitro and in vivo conditions. Levofloxacin dramatically decreased various types of follicles and the size of theca and granulosa layers. Quite the opposite, the number of follicular ranging from primary to mature, atresia, and corpus luteum was significantly exacerbated after treatment with levofloxacin. These data indicate that levofloxacin administration, particularly at higher concentrations, not only causes morphological changes in the ovarian tissue but also decreases the number of oocytes and, consequently, the chance of fertilization in females.
The exact mechanism in which levofloxacin antibiotic affects the function of ovarian tissue and results in ovarian lesions has remained unclear. Previously, Ahmadifar et al. (14) reported that levofloxacin destroys ovary tissue and causes an imbalance in the serum levels of female sex hormones. In the current study, we proposed levofloxacin induces ovarian tissue failure through apoptosis of ovarian follicles. To support this hypothesis, we considered the expression of apoptosis-related genes in levofloxacin-exposed ovary tissues in vivo and in vitro. Furthermore, we found that although fluoroquinolone levofloxacin induced the expression of Bax and Caspase-3 genes, it reduced the expression of Bcl2 in both in vivo and in vitro models in a concentration-depended manner. These data emphasize that apoptosis of ovarian follicles is likely the primary mechanism of levofloxacin toxicity on ovarian tissue and decreased number of follicle cells. Several studies reported levofloxacin stimulates apoptosis of various cells. For example, Serebryakova et al. (18) reported apoptotic activity of levofloxacin in patients with infiltrative pulmonary tuberculosis. Wang et al. (19) found that levofloxacin caused cytotoxic effects on rabbit meniscus cells via apoptosis induction. A previous study reported that levofloxacin administration is associated with higher levels of FSH and LH, a significant decrease in sperm counts, primary and secondary spermatogonia, and spermatocyte cells in the seminiferous tubules of male rats (20). 
Given the potential effect of levofloxacin on apoptosis of follicle cells, we evaluated its toxicity on ovarian cancer cell apoptosis to introduce it as a new drug for cancer therapy. Our findings indicate that levofloxacin treatments, especially at higher concentrations, significantly decreased the viability of SKOV3 cells. This finding was confirmed by flow cytometric analysis of Annexin V-FITC test. Real-time PCR and Western Blotting revealed upregulation of Bax and Caspase-3; however, down-expression of Bcl2 in SKOV3 cells following exposure to levofloxacin. These data indicate that levofloxacin exerted potent anticancer activity. To support this hypothesis, many studies reported levofloxacin's anti-cancer effect on various cancer cells. For example, Song et al. (6) evaluated the impact of antibiotic levofloxacin on lung cancer treatment in both in vivo and in vitro models. They revealed that levofloxacin suppressed the expansion of cancer cells and induced their apoptosis by inhibiting the activities of the mitochondrial electron transport chain complex. Inhibition of mitochondrial respiration was associated with depletion of cellular ATP, massive production of reactive oxygen species, and cancer cell apoptosis. Therefore, these researchers concluded that levofloxacin is a helpful addition to treating lung cancer by targeting mitochondria (6). In another study, Sun et al. (21) reported that levofloxacin treatment arrested human hepatocarcinoma cells growth and induced cancer cells apoptosis by inducing Bax and Caspases expressions and decreasing the Bcl2 expression. Similarly, levofloxacin et al. (22) found that levofloxacin exhibited a strong cytotoxicity effect against human hepatocarcinoma cells through the mitochondrial-dependent pathways.

Taken together, we conclude that levofloxacin destroys the structure and function of ovarian tissues and decreases the number of follicle cells at higher concentrations. The reproductive toxicity effect of levofloxacin is likely mediated through the induction of apoptosis-related factors such as Bax and Caspases. Furthermore, levofloxacin exhibited a strong anticancer effect on cancerous ovarian cells. It suppressed cancerous cell proliferation and induced their apoptosis via stimulating Bax and Caspase-3 and decreasing Bcl2 expression. The subsequent activation of Bax and Caspase-3 cascades leads to levofloxacin-induced apoptosis in human SKOV3 cells. Levofloxacin may, therefore, have therapeutic effects for treating ovarian cancer or other types of solid cancer.

??

Conflicts of Interest: ??

Funding: ??

Ethical considerations: ???
Authors' contributions: ???

1. Yadav V, Talwar P. Repositioning of fluoroquinolones from antibiotic to anti-cancer agents: An underestimated
   truth. Biomed Pharmacother. 2019;111:934-46. doi: 10.1016/j.biopha.2018.12.119 .
2. Bucaneve G, Micozzi A, Menichetti F, Martino P, Dionisi MS, Martinelli G, et al. Levofloxacin to prevent bacterial infection in patients with cancer and neutropenia. N Engl J Med. 2005;353(10):977-87. doi: 10.1056/NEJMoa044097 . [PubMed: 16148283 ].
3. Carbon C. Levofloxacin adverse effects, data from clinical trials and pharmacovigilan. Therapie. 2001;56(1):35-40. [PubMed: 11322015 ].
4. Tunitskaya VL, Khomutov AR, Kochetkov SN, Kotovskaya SK, Charushin VN. Inhibition of DNA gyrase by levofloxacin and related fluorine-containing heterocyclic compounds. Acta Naturae. 2011;3(4):94-9. [PubMed: 22649708] .
5. He X, Yao Q, Hall DD, Song Z, Fan D, You Y, et al. Levofloxacin exerts broad-spectrum anticancer activity via regulation of THBS1, LAPTM5, SRD5A3, MFAP5 and P4HA1. Anticancer Drugs. 2022;33(1):235-46. doi: 10.1097/cad.0000000000001194. [PubMed: 34419964 ].
6. Song M, Wu H, Wu S, Ge T, Wang G, Zhou Y, et al. Antibiotic drug levofloxacin inhibits proliferation and induces apoptosis of lung cancer cells through inducing mitochondrial dysfunction and oxidative damage. Biomed Pharmacother. 2016;84:1137-43. doi: 10.1016/j.biopha.2016.10.034 . [PubMed: 27780143 ].
7. Kloskowski T, Szeliski K, Fekner Z, Rasmus M, Dąbrowski P, Wolska A, et al. Ciprofloxacin and Levofloxacin as Potential Drugs in Genitourinary Cancer Treatment-The Effect of Dose-Response on 2D and 3D Cell Cultures. Int J Mol Sci. 2021;22(21):1-27. doi: 10.3390/ijms222111970 . [PubMed: 34769400 ].
8. McCormick M, Friehling E, Kalpatthi R, Siripong N, Smith K. Cost-effectiveness of levofloxacin prophylaxis against bacterial infection in pediatric patients with acute myeloid
   leukemia. Pediatr Blood Cancer. 2020;67(10):1-19. doi: 10.1002/pbc.28469 . [PubMed: 32710709 ].
9. Urueta-Robledo J, Ariza H, Jardim JR, Caballero A, García-Calderón A, Amábile-Cuevas CF, et al. Moxifloxacin versus levofloxacin against acute exacerbations of chronic bronchitis: the Latin American Cohort. Respir Med. 2006;100(9):1504-11. doi: 10.1016/j.rmed.2006.01.013 . [PubMed: 16504492 ].
10. Holtom PD, Pavkovic SA, Bravos PD, Patzakis MJ, Shepherd LE, Frenkel B. Inhibitory effects of the quinolone antibiotics trovafloxacin, ciprofloxacin, and levofloxacin on osteoblastic cells in vitro. J Orthop Res. 2000;18(5):721-7. doi: 10.1002/jor.1100180507 . [PubMed: 11117292 ].
11. Erden B, Ulak G, Yildiz F, Utkan T, Ozdemirci S, Gacar N. Antidepressant, anxiogenic, and antinociceptive properties of levofloxacin in rats and mice. Pharmacol Biochem Behav. 2001;68(3):435-41. doi: 10.1016/s0091-3057(00)00468-8 . [PubMed: 11325396 ].
12. Anderson VR, Perry CM. Levofloxacin : a review of its use
    as a high-dose, short-course treatment for bacterial infection. Drugs. 2008;68(4):535-65. doi: 10.2165/00003495-200868040-00011 . [PubMed: 18318569 ].
13. Johnson A. Intracellular mechanisms regulating cell survival in ovarian follicles. Anim Reprod Sci. 2003;78(3-4):185-201. doi: 10.1016/s0378-4320(03)00090-3 . [PubMed: 12818644 ].
14. Ahmadifar M, Vahidi N, Fathi R. The Study of Effect of Levofloxacin on Disorders of Female Hormones in Rats. Anat Sci J. 2014;11(2):71-4.
15. Norrby SR, Petermann W, Willcox PA, Vetter N, Salewski E. A comparative study of levofloxacin and ceftriaxone in the treatment of hospitalized patients with pneumonia. Scand J Infect
    Dis. 1998;30(4):397-404. doi: 10.1080/00365549850160710 . [PubMed: 9817522 ].
16. Carbon C. Comparison of side effects of levofloxacin versus other fluoroquinolones. Chemotherapy. 2001;47(3):9-14. doi: 10.1159/000057839 . [PubMed: 11549784 ].
17. Claudio T, Marcelo RP, Susana C, Ernesto G, Alberto N. Study of sperm apoptosis and seminal oxidant capacity in infertile patients with genital tract infections evaluation of the efficacy of levofloxacin in two therapeutic protocols. Advanc Sex Med. 2012;2(2):21-4. doi: 10.4236/asm.2012.22004 .
18. Serebryakova VA, Urazova OI, Novitsky VV, Vengerovskii AI, Kononova TE, Vasil'eva OA, et al. Effects of levofloxacin on blood lymphocyte apoptosis in patients with pulmonary tuberculosis: an in vitro study. Bull Exp Biol Med. 2019;168(1):109-12. doi: 10.1007/s10517-019-04659-x . [PubMed: 31773352 ].
19. Wang L, Wu Y, Tan Y, Fei X, Deng Y, Cao H, et al. Cytotoxic effects of the quinolone levofloxacin on rabbit meniscus cells. J Appl Toxicol. 2014;34(8):870–7. doi: 10.1002/jat.2903 . [PubMed: 23813946 ].
20. Ahmadi R, Ahmadifar M, Safarpour E, Vahidi-Eyrisofla N, Darab M, Eini AM, et al. The Effects of Levofloxacin on Testis Tissue and Spermatogenesis in Rat. Cell J. 2016;18(1):112-6. doi: 10.22074/cellj.2016.3994 . [PubMed: 27054126 ].
21. Sun JP, Shi ZY, Liu SM, Kang YH, Hu GQ, Huangfu CS, et al. Trimethoxy-benzaldehyde levofloxacin hydrazone inducing the growth arrest and apoptosis of human hepatocarcinoma cells. Cancer Cell Int. 2013;13(1):1-10. doi: 10.1186/1475-2867-13-67 . [PubMed: 23819802 ] .
22. Huo F, Tang N. Fan Y, Liu S, Zhang Y, L iang H, Hu G, al. e. Benzaldehyde levofloxacin schiff base induces apoptosis of human hepatocarcinoma cells. Chin Pharmacol Bull. 2015;6:821-6.