Determination of Different Fluoroquinolone Mechanisms Among Clinical Isolates of Acinetobacter baumannii in Tehran, Iran

AUTHORS

Hatef Khayat 1 , Nourkhoda Sadeghifard 1 , Iraj Pakzad 1 , Lila Azimi 2 , Somayeh Delfani 3 , Koroush Sayehmiri 1 , Setareh Soroush 3 , Lidija Bogdanovic 4 , Morovat Taherikalani 3 , *

1 Clinical Microbiology Research Center, Ilam University of Medical Sciences, Ilam, Iran

2 Pediatric Infections Research Center, Mofid Childeren Hospital, Shahid Beheshti University of Medical, Sciences, Teharn, Iran

3 Razi Herbal Medicines Research Center, Department of Microbiology, School of Medicine, Lorestan University of Medical Sciences, Khorramabad, Iran

4 Department of Public Health, University of Naples, Naples, Italy

How to Cite: Khayat H, Sadeghifard N, Pakzad I, Azimi L, Delfani S, et al. Determination of Different Fluoroquinolone Mechanisms Among Clinical Isolates of Acinetobacter baumannii in Tehran, Iran, Iran Red Crescent Med J. 2017 ; 19(9):e58798. doi: 10.5812/ircmj.58798.

ARTICLE INFORMATION

Iranian Red Crescent Medical Journal: 19 (9); e58798
Published Online: July 26, 2017
Article Type: Brief Report
Received: November 23, 2016
Revised: February 6, 2017
Accepted: March 4, 2017
Crossmark

Crossmark

CHEKING

READ FULL TEXT
Abstract

Background: Acinetobacter baumannii isolates resistant to fluoroquinolones, such as levofloxacin and ciprofloxacin are being increasingly developed every day.

Objectives: In this study, ciprofloxacin resistance in A. baumannii isolates was determined by the presence or absence of efflux pump inhibitors, as the efflux pumps play an important role in the creation of ciprofloxacin resistance.

Methods: One hundred and three Acinetobacter isolates were collected from ventilator-associated pneumonia (VAP) and burn patients of Tehran hospitals, Iran, during six months of 2014. Susceptibility rates of the isolates to levofloxacin and ciprofloxacin antibiotics were assessed using the agar disk diffusion and broth microdilution. The effects of the efflux pump inhibitors including phenylalanine-arginine β-naphthylamide (PAβN) and 1-(1-naphtylmethyl)-piperazine (NMP) on ciprofloxacin resistance were investigated. Further, the quinolone resistance qnrA, qnrB, qnrS, and adeABC genes were evaluated using the polymerase chain reaction (PCR) test. Finally, to examine the mutation in quinolone resistance-determining regions, the PCR products of the gyrA and parC genes were sequenced.

Results: According to the results of the antibiogram test, 74.7% and 33% of the studied isolates were resistant to ciprofloxacin and levofloxacin, respectively. Also, there was a significant relationship between the type of the specimen and resistance to ciprofloxacin (P = 0.02) and resistance to levofloxacin (P = 0.04). As for the synergistic study of the inhibitors with ciprofloxacin, the reduction of minimum inhibitory concentration (MIC) was observed in 40% and 56.6% of the isolates in the presence of PAβN and NMP, respectively. The prevalence rates of qnrA, qnrB, qnrS, AdeA, AdeB, and AdeC genes were 0%, 0%, 3.9%, 100%, 100% and 100%, respectively. In all the resistant isolates, mutation of in the gyrA gene was observed, but no mutation was seen in the parC gene.

Conclusions: The presence of the efflux pumps and the gyrA gene mutation are still considered as the most important factors causing fluoroquinolone resistance; however, identification of the qnr genes for the first time in Tehran hospitals, Iran, can lead to further concerns in the future.

Keywords

A. baumannii Resistance Patterns Fluoroquinolones

Copyright © 2017, Iranian Red Crescent Medical Journal. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

1. Background

Acinetobacter baumannii is a Gram-negative, nonfermentative and oxidase-negative coccobacillus which, in nature and especially in hospital environments, causes opportunistic infections such as meningitis, pneumonia, respiratory and urinary tract infections, infections of patients hospitalized in intensive care unit (ICU), and burn infections. (1-4). Bacteremia is caused by toxic shock in 25% to 30% of the cases and usually occurs due to disseminated intravascular coagulation. Colonization might occur after invasive infection and often among burn patients (5, 6). The mortality rate in the hospitals is high, about 23% and 43% in the hospitalized patients and patients in ICU, respectively (7). Today, Acinetobacter isolates have become resistant to many antibiotics. According to the reports, more than 80% of the isolates are aminoglycoside-resistant; further, resistance to quinolones is also expanding, which leads to an increase in therapeutic problems and concerns (8). Both inherent and acquired mechanisms could result in such resistances (9). Resistance to quinolones is developed through different methods, one of which is the changes occurred in the expression of the efflux pumps. The efflux pump in A. baumannii is the AdeABC pump and is of great importance in terms of resistance creation (10). One of the mechanisms to deal with the antibiotic resistance is to block or disrupt the mechanisms leading to resistance. Inhibiting the efflux pumps is a strategy of acting through disrupting the energy system required for drug disposal, blocking the efflux pump, or preventing the formation and assembly of the pump. The PAβN inhibits the efflux pump by blocking, and exhibits a state of competition with antibiotics, while the mechanism of 1-(1-naphtylmethyl)-piperazine (NMP) inhibitor has not been known yet. Determining ciprofloxacin resistance in A. baumannii isolates was performed both in the presence and in the absence of efflux pump inhibitors (11-14). Another mechanism that causes resistance to quinolones is the presence of quinolone resistance (qnr) genes located on the plasmid, which leads to a low-level resistance to quinolones. These proteins are of low frequency, and most of the studies have been conducted on the bacteria of the Enterobacteriaceae family. Studies performed to identify the qnr genes in A. baumannii isolates have not been so successful (15). Another important mechanism in the creation of quinolones resistance is mutation in quinolone resistance-determining regions (QRDR), where the target enzymes of DNA gyrase (gyrA) and Topoisomerase IV (parC) are affected. The major impact of quinolones is on the target enzymes such as DNA gyrase, which inhibit the transcription process by binding to and causing mutation in the gene of this enzyme (16).

Based on the above-mentioned requirements of increased Acinetobacter resistance to most of the antibiotics and the importance of fluoroquinolones in the treatment of infections caused by these isolates, the present study investigated various mechanisms of resistance to fluoroquinolones, efflux pump, qnr genes or mutation, as well as reduction of resistance through inhibition of efflux pumps by two efflux pump inhibitor compounds of PAβN and NMP.

2. Methods

2.1. Bacterial Isolates and Identification

In this cross sectional study, 103 Acinetobacter isolates were collected from two general hospitals in Tehran, Iran, during six months of 2014. Seventy isolates were collected from the ventilator-associated pneumonia (VAP) patients from the ICU of Rasool Akram Hospital and 33 isolates from burn patients of Shahid Motahhari Hospital. To confirm phenotypic and genotypic of the specimens of A. baumannii, biochemical tests and polymerase chain reaction (PCR) test were used. After culturing the bacteria on the nutrient agar medium, routine tests including growth at temperatures of 45°C and 37°C, and acid production in oxidative fermentative glucose (Merck, Germany) were conducted to identify the species of A. baumannii (7). For final confirmation of the Acinetobacter isolates, inherent genes, including blaOXA-51-like and gyrB, which are the main characteristics of A. baumannii species, were tested using the PCR test) Eppendorf, Mastercycler Gradient). After confirmation, specimens were transmitted to a medium consisting of 15% glycerol and 85% brain heart infusion (BHI) liquid medium) Merck, Germany) for storage and maintenance in a freezer with the temperature of -70°C (7).

2.2. Antibiotic Susceptibility Testing

Determination of susceptibility to levofloxacin and ciprofloxacin antibiotics (MAST, England) was conducted using a disk agar diffusion method. To analyze the susceptibility rates, the diameters of the zones of inhibition were measured and categories of susceptible, intermediate or resistant were determined. After examination of the antibiogram results, ciprofloxacin resistant and intermediate isolates were used to conduct minimum inhibitory concentration (MIC) for ciprofloxacin (sigma, Aldrich Belgium‎) using broth microdilution. The CLSI 2015 criteria were used in both methods (17).

2.3. Examining the Effects of PAβN and NMP Compounds on Minimum Inhibitory Concentration of Ciprofloxacin

The PAβN and NMP (sigma, Aldrich Belgium) compounds were prepared and added to ciprofloxacin. Based on the protocol, the concentration of PAβN should be 5 mg/mL; thus, 5 mg of this material was solved in 1 mL of distilled water; further, the amount that should be added to each well was 2 μL; therefore, the inhibitor was mixed with the culture medium and then added to each well. The size of the culture medium was reduced and an inhibitor of the same amount was added, so that in each microplate, there were 48 μL of the adjusted Mueller-Hinton medium (Merck, Germany) and 2 μL of PAβN. After dilution of the antibiotic, the bacterial suspension was added by the same amount, ie, 50 μL (final volume of 100 μL), and all the remaining steps were conducted as MIC (18). As for the NMP inhibitor, based on the protocol, first 100 mg of the inhibitor was solved in 2 mL of DMSO, and then 2 mL of 0.25 molar HCL was added to it. Next, the volume reached 10 mL using distilled water. Then, after preparation, it was added to the culture medium, the same way as PAβN, and the MIC steps were performed (19).

2.4. Determination of Frequency of Antibiotic-Resistant Genes

The PCR test was used to examine the presence of genes including qnrA, qnrB, qnrS, and adeABC among Acinetobacter isolates. DNA of the specimens was extracted using the phenol-chloroform-isoamyl alcohol method. Then, the used primers were diluted, in accordance with the protocol, by adding a certain amount of sterile distilled water and, thereby, the solutions were provided (Table 1). The final volume for each reaction was 25 μL. For preparation of the reactions, the following steps were performed: The master mix was provided based on the number of specimens supposed to undergo PCR. Twenty μL of master mix and 5 μL of the specimen were added to the vial; thus, the total volume for the test was 25 μL. The vials were placed inside the thermocycler. The temperature conditions of the PCR reaction were: the initial denaturation at 95°C for 1 minutes, 35 cycles at 94°C for 54 seconds, annealing at 53°C for 43 seconds, extension at 72°C for 1 minutes, and final extension at 72°C for 10 minutes. After the PCR reaction on the DNA resulted from the specimens, the products reproduced in PCR were electrophoresed on 1.5% agarose to observe DNA pieces. The stain safe DNA (SYBR) was used for staining DNA pieces. The voltage required for electrophoresis was 100 V and its duration was 50 minutes. Five microliters of the PCR product was mixed with 4 μL of Loading Buffer 6X (Thermo Scientific) and then placed in the gel wells for electrophoresis (BIO-RAD power pac basic electrophoresis power supply) (20, 21).

Table 1. Oligonucleotide Primers Used in the Study
GeneNucleotide Sequence (5’-3’)Amplicon Size (bp)References
blaOXA-51-likeTAATGCTTTGATCGGCCTTG353(22)
TGGATTGCACTTCATCTTGG
gyrBTGG ATT GCA CTT CAT CTT GG294(23)
AACGGAGCTT-GTCAGGGTTA
TGG CAC TTC ACT ATC AAT AC490
qnrAAGAGGATTTCTCACGCCAGG580(20)
TGCCAGGCACAGATCTTGAC
qnrBGGMATHGAAATTCGCCACTG264(20)
TTTGCYGYYCGCCAGTCGAA
qnrSGCAAGTTCATTGAACAGGGT428(20)
TCTAAACCGTCGAGTTCGGCG
Ade ACTCTAGCCGATGTCGCTCAA510(24)
ATACCTGAGGCTCGCCACTG
Ade BAAGTATGAATTGATGCTGC862(24)
AACGATTATATTGTTGTGG
Ade CTGCGGCAGGTTAGCCCATCG435(24)
GCGGAACAGGATGACCTGCT
parCAAACCTGTTCAGCGCCGCATT327(25)
AAAGTTGTCTTGCCATTCACT
gyrAAAATCTGCCCGTGTCGTTGG285(26, 27)
GCCATACCTACGGCGATACC

2.5. Sequencing the Quinolone Resistance-Determining Regions to Examine Mutation

For sequencing the QRDR region, first the PCR with the volume of 50 μL was conducted for gyrA and parC genes; then, the reaction products were confirmed through observing the size band in the agarose gel (Gel Doc XR+, Bio-Rad). Afterwards, the PCR products of both genes were sequenced through double-stranded sequencing using the primer pairs. The sequencing was performed by the Korean Macrogen Inc, and the subsequent steps, including the mutagenic sequence analysis and nucleotide conversion to amino acid, were performed using ClustalW (Lasergene MegAlign software package v.6.1).

2.6. Statistical Analysis

Chi-square analysis using the SPSS software version 21 was used for statistical analyses. A P value ≤ 0.05 was considered as statistically significant.

3. Results

3.1. Phenotypic and Genotypic Verification of Specimens

After the complementary biochemical tests, all of the one hundred and three isolates were identified as A. baumannii. All the specimens contained gyrB and blaOXA-51 inherent genes identified as A. baumannii.

3.2. Determination of Susceptibility to Antibiotics

According to the results of the antibiogram test, 74.7% and 33% of the studied isolates were resistant to ciprofloxacin and levofloxacin, respectively. The antibiotic susceptibility pattern of the studied A. baumannii strains based on the type of the specimen showed that levofloxacin had a greater effect on A. baumannii species compared to ciprofloxacin (Table 2). Also, statistical analyses showed that there was a significant relationship between the resistance to ciprofloxacin (P = 0.02) and levofloxacin and the type of the specimen (P = 0.04). Also, the results of the broth microdilution method showed that 34.5% of the isolates had a MIC of 256 for ciprofloxacin.

Table 2. Antibiotic Susceptibility Pattern of A. baumannii Strains According to the Types of the Specimen
AntimicrobialSpecimenTotal (N = 103) (%)
VAP (%)Burn (%)
CiprofloxacinResistant67Resistant9074.7
Intermediate9Intermediate46.8
Susceptible24Susceptible618.4
LevofloxacinResistant40Resistant1833
Intermediate11Intermediate69.7
Susceptible49Susceptible7656.3

Abbreviation: VAP, ventilator-associated pneumonia.

3.3. Examining the Effects of PAβN and NMP Compounds on the Minimum Inhibitory Concentration of Ciprofloxacin

The results obtained from combining ciprofloxacin with efflux pump inhibitors showed that 56.6% of the isolates demonstrated MIC reduction in the presence of NMP, while the same value for phenylalanine-arginine β-naphthylamide (PAβN) was about 40%. It seems that NMP had a better effect on reduction of MIC and, consequently, on reduction of resistance compared to PAβN. However, 2.7% and 6.10% of the isolates became susceptible to ciprofloxacin in the presence of NMP and PAβN, respectively. Phenotypic and genotypic characteristics of highly ciprofloxacin resistant A. baumannii isolated from burns and VAP samples have been shown in Tables 3 and 4, respectively.

Table 3. Phenotypic and Genotypic Characteristics of Highly Ciprofloxacin Resistant A. baumannii Isolated From Burn Samples
NOMIC CIP μg/mLMIC (CIP+NMP μg/mL)MIC (CIP+PAβN μg/mL)Gyr A Ser 83 to LeuPar C
1646432+-
232816+-
364832+-
432816+-
532328+-
6128128128+-
7323216+-
812864128+-
9323216+-
10256256256+-
1112812864+-
1212812864+-
1325625664+-
1425612864+-
1525612864+-
1612812816+-
17256256128+-
18256256128+-
19256256128+-
20256256128+-
2125664128+-
2225632256+-
23256256128+-

Abbreviations: CIP, ciprofloxacin; NMP, 1-(1-naphtylmethyl)-piperazine; PaβN, phenylalanine-arginine β-naphthylamide.

Table 4. Phenotypic and Genotypic Characteristics of Highly Ciprofloxacin Resistant A. baumannii Isolated From Ventilator-Associated Pneumonia Samples
NOMIC (CIP μg/mL)MIC (CIP+NMP μg/mL)MIC (CIP+PAβN μg/mL)Gyr A (Ser 83 to Leu)Par C
1256256256+-
232162+-
3128128128+-
4641688+-
5256256256+-
6256128256+-
71283264+-
81283232+-
912812864+-
103288+-
1132432+-
12128128128+-
1325625664+-
14256256256+-
15256256256+-
161286464+-
1712812864+-
18323232+-
19256256128+-
201283264+-
2125612832+-
2212812864+-
23641664+-
24256256256+-
25643264+-
26321632+-
27256256256+-
2812864128+-
2925625664+-
30256256256+-
313284+-
32256256256+-
33256256128+-
34128128128+-
3564648+-
36646432+-
37256256128+-
38643232+-
39256128128+-
40321632+-
4125625664+-
421283264+-
4312812832+-
44256256128+-

Abbreviations: CIP, ciprofloxacin; MIC, minimum inhibitory concentration; NMP, 1-(1-naphtylmethyl)-piperazine; PaβN, phenylalanine-arginine β-naphthylamide.

3.4. Determination of Frequency of Antibiotic-Resistant Genes

All isolates were positive for AdeA, AdeB and AdeC genes (100%). For the first time, 3.9% of the strains contained the qnrS gene. No strains carried qnrA and qnrB genes (0%).

3.5. Sequencing the Quinolone Resistance-Determining Regions to Examine Mutation

The gyrA gene was observed to have a length of 344 and, after purification, the PCR product was sequenced. Converting this sequence into the amino acid sequence and its comparison with the gyrA protein sequence of the wild-type strain of (ATCC 19606) accession no. AF100557 revealed that in all the ciprofloxacin-resistant isolates, the mutation has occurred in the gyrA gene, which was predictable as this mutation is considered the main mechanism of inherent resistance to ciprofloxacin. However, no mutation was seen in parC, and this protein is less important in terms of inherent resistance.

4. Discussion

Due to the widespread prevalence of multidrug-resistant Acinetobacter, the treatment of A. baumannii infections is considered as a clinical problem in many European countries (28). The present study investigated the resistance of these isolates to fluoroquinolone antibiotics (ciprofloxacin and levofloxacin) and the mechanisms that cause resistance. In this study, the antibiotic resistance rates of 103 Acinetobacter isolates to ciprofloxacin and levofloxacin were 74.7% and 33%, respectively. In contrast to ciprofloxacin, most of the isolates were susceptible to levofloxacin; this was also confirmed by the results of the broth microdilution method, so that 34.5% of the isolates had a MIC of 256 for ciprofloxacin. It seems that levofloxacin has a higher efficiency than ciprofloxacin. The study by Adams et al. on 65 A. baumannii isolates led to similar results, that is, 95.9% of the isolates were ciprofloxacin-resistant (29). In another study (2015) in Iran by Gholami et al., 100% (n = 65) of the A. baumannii isolates were resistant to ciprofloxacin (24). All of these results indicated the high level of ciprofloxacin resistance in A. baumannii isolates. Results of the present study showed the MIC reduction of ciprofloxacin among A. baumannii isolates in the presence of the efflux pump inhibitors including NMP and PAβN. Moreover, examining the MIC status of ciprofloxacin in the presence of the two efflux pump inhibitors and comparing them with each other revealed that NMP has a more effective role in reduction of MIC compared to PABN. By investigating the effect of NMP and PAβN on ciprofloxacin resistance, Golanbar et al. showed that the MIC of the A. baumannii isolates is reduced in the presence of both compounds (30). Further, Waltin et al. demonstrated the considerable effect of both NMP and PAβN compounds on MIC of ciprofloxacin; the inhibitory effect of NMP was higher than that of PAβN (18). In contrast to the above-mentioned studies, Ribera et al. observed that PAβN had no effect on MIC of ciprofloxacin (31); however, in general, in many studies such as the present one, the inhibitory effect of both compounds on the performance of efflux pumps has been observed (32). In the current study, the efflux pump genes, adeABC, also were evaluated using the PCR test. All isolates harbored the adeABC genes. This reflects the role of efflux pumps to the resistance of ciprofloxacin antibiotic. Ardebili et al. investigated the presence of adeABC genes among the 68 A. baumannii isolates in Iran and showed that all isolates were resistant to ciprofloxacin, and positive for adeABC genes (33). Srinivasan et al. detected the adeB efflux gene among A. baumannii isolates (n = 83) originated from two hospital settings in central Ohio, the adeB efflux gene was found in 53% (44/83) of the isolates only (26). The results of the present study were consistent with previous studies that demonstrate the important role of efflux pumps in the resistance to ciprofloxacin. However, the expressions of genes coding for these pumps were measured by real-time PCR and this is a limitation of our study. Another mechanism leading to the quinolone resistance is the presence of QNR proteins that cause low-level resistance to the quinolones (34). Due to the limited number of studies on these proteins among A. baumannii isolates, the present study investigated the isolates in terms of genes, which encode this protein. The qnrA and qnrB genes were observed in none of the isolates, but unexpectedly, 4 isolates had the qnrS gene. Based on this report, of the 4 isolates containing this gene, 2 isolates were ciprofloxacin-resistant and 2 were intermediate. Hujer et al. investigated the antibiotic resistance genes among 75 isolates of A. baumannii and the QNR genes were not observed in any of the isolates (35). As for sequencing, it was shown that all the resistant strains had the mutation of leucine83 → arginine in the gyrA gene, but no mutation leading to resistance was observed in this parC. Wisplinghoff et al. sequenced the QRDR regions of 147 A. baumannii isolates. In some of the isolates resistant to ciprofloxacin, any mutations leading to resistance have been observed that appear to be other mechanisms involved in resistance (36). Most of the previous studies have focused on the mutation in these two genes (22) and their results are quite similar to the results of the present study. In a study by Hamonda et al., of the 9 ciprofloxacin-resistant isolates, 2 isolates exhibited mutation in the parC gene (8). Moreover, in most of the studies, the mutation in the gyrA gene was significantly higher than that in the parC, and the parC gene was considered as the second objective of the fluoroquinolone antibiotics. In the present study, it seems that the efflux pumps and mutation in the gyrA gene plays an important role in inherent resistance to ciprofloxacin.

Acknowledgements

Footnote

References

  • 1.

    Xia J, Gao J, Tang W. Nosocomial infection and its molecular mechanisms of antibiotic resistance. Bioscience trends. 2016;

  • 2.

    Chen CH, Lin LC, Chang YJ, Chen YM, Chang CY, Huang CC. Infection Control Programs and Antibiotic Control Programs to Limit Transmission of Multi-Drug Resistant Acinetobacter baumannii Infections: Evolution of Old Problems and New Challenges for Institutes. Int J Environ Res Public Health. 2015; 12(8) : 8871 -82 [DOI][PubMed]

  • 3.

    Weber BS, Harding CM, Feldman MF. Pathogenic Acinetobacter: from the Cell Surface to Infinity and Beyond. J Bacteriol. 2015; 198(6) : 880 -7 [DOI][PubMed]

  • 4.

    Karaiskos I, Giamarellou H. Multidrug-resistant and extensively drug-resistant Gram-negative pathogens: current and emerging therapeutic approaches. Expert Opin Pharmacother. 2014; 15(10) : 1351 -70 [DOI][PubMed]

  • 5.

    Doi Y, Murray GL, Peleg AY. Acinetobacter baumannii: Evolution of Antimicrobial Resistance-Treatment Options. Seminars in respiratory and critical care medicine. 2015;

  • 6.

    Seifert H, Dijkshoorn L, Gerner-Smidt P, Pelzer N, Tjernberg I, Vaneechoutte M. Distribution of Acinetobacter species on human skin: comparison of phenotypic and genotypic identification methods. J Clin Microbiol. 1997; 35(11) : 2819 -25 [PubMed]

  • 7.

    Saed S, Yazdanpanah M, Lal-Dehghani M, Khalighi A, Honarmand M, Afrough P. Emerging Trend of Acinetobacter Nosocomial Infection in Northeast of Iran. J Med Bacteriol. 2015; 2(3-4) : 56 -61

  • 8.

    Hamouda A, Amyes SG. Novel gyrA and parC point mutations in two strains of Acinetobacter baumannii resistant to ciprofloxacin. J Antimicrob Chemother. 2004; 54(3) : 695 -6 [DOI][PubMed]

  • 9.

    Potron A, Poirel L, Nordmann P. Emerging broad-spectrum resistance in Pseudomonas aeruginosa and Acinetobacter baumannii: Mechanisms and epidemiology. Int J Antimicrob Agents. 2015; 45(6) : 568 -85 [DOI][PubMed]

  • 10.

    Rumbo C, Gato E, Lopez M, de Alegria CR, Fernandez-Cuenca F, Martínez-Martínez L. The Contribution of Efflux Pumps, Porins and β-Lactamases to Multi-drug Resistance in Clinical Isolates of Acinetobacter baumannii. Antimicrobial Agent Chemoth. 2013; : 730 -13

  • 11.

    Blanchard C, Barnett P, Perlmutter J, Dunman PM. Identification of Acinetobacter baumannii serum-associated antibiotic efflux pump inhibitors. Antimicrob Agents Chemother. 2014; 58(11) : 6360 -70 [DOI][PubMed]

  • 12.

    Krishnamoorthy S, Shah BP, Lee HH, Martinez LR. Microbicides Alter the Expression and Function of RND-Type Efflux Pump AdeABC in Biofilm-Associated Cells of Acinetobacter baumannii Clinical Isolates. Antimicrob Agents Chemother. 2015; 60(1) : 57 -63 [DOI][PubMed]

  • 13.

    Beheshti M, Talebi M, Ardebili A, Bahador A, Lari AR. Detection of AdeABC efflux pump genes in tetracycline-resistant Acinetobacter baumannii isolates from burn and ventilator-associated pneumonia patients. J Pharm Bioallied Sci. 2014; 6(4) : 229 -32 [DOI][PubMed]

  • 14.

    Opperman TJ, Kwasny SM, Kim HS, Nguyen ST, Houseweart C, D'Souza S, et al. Characterization of a novel pyranopyridine inhibitor of the AcrAB efflux pump of Escherichia coli. Antimicrob Agents Chemother. 2014; 58(2) : 722 -33 [DOI][PubMed]

  • 15.

    Khorsi K, Messai Y, Hamidi M, Ammari H, Bakour R. High prevalence of multidrug-resistance in Acinetobacter baumannii and dissemination of carbapenemase-encoding genes blaOXA-23-like, blaOXA-24-like and blaNDM-1 in Algiers hospitals. Asian Pac J Trop Med. 2015; 8(6) : 438 -46 [DOI][PubMed]

  • 16.

    Lopes BS, Amyes SG. Insertion sequence disruption of adeR and ciprofloxacin resistance caused by efflux pumps and gyrA and parC mutations in Acinetobacter baumannii. Int J Antimicrob Agents. 2013; 41(2) : 117 -21 [DOI][PubMed]

  • 17.

    Clinical and Laboratory Standards Institute. . Performance standards for antimicrobial susceptibility testing:Twentieth informational supplement M100-S23. 2015;

  • 18.

    Valentine SC, Contreras D, Tan S, Real LJ, Chu S, Xu HH. Phenotypic and molecular characterization of Acinetobacter baumannii clinical isolates from nosocomial outbreaks in Los Angeles County, California. J Clin Microbiol. 2008; 46(8) : 2499 -507 [DOI][PubMed]

  • 19.

    Bean DC, Wareham DW. Paradoxical effect of 1-(1-naphthylmethyl)-piperazine on resistance to tetracyclines in multidrug-resistant Acinetobacter baumannii. J Antimicrob Chemother. 2009; 63(2) : 349 -52 [DOI][PubMed]

  • 20.

    Okade H, Nakagawa S, Sakagami T, Hisada H, Nomura N, Mitsuyama J, et al. Characterization of plasmid-mediated quinolone resistance determinants in Klebsiella pneumoniae and Escherichia coli from Tokai, Japan. J Infect Chemother. 2014; 20(12) : 778 -83 [DOI][PubMed]

  • 21.

    Queenan AM, Davies TA, He W, Lynch AS. Assessment of the combination of doripenem plus a fluoroquinolone against non-susceptible Acinetobacter baumannii isolates from nosocomial pneumonia patients. J Chemother. 2013; 25(3) : 141 -7 [DOI][PubMed]

  • 22.

    Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents. 2006; 27(4) : 351 -3 [DOI][PubMed]

  • 23.

    Chen TL, Lee YT, Kuo SC, Yang SP, Fung CP, Lee SD. Rapid identification of Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii with a multiplex PCR assay. J Med Microbiol. 2014; 63 : 1154 -9 [DOI][PubMed]

  • 24.

    Gholami M, Hashemi A, Hakemi-Vala M, Goudarzi H, Hallajzadeh M. Efflux Pump Inhibitor Phenylalanine-Arginine Beta-Naphthylamide Effect on the Minimum Inhibitory Concentration of Imipenem in Acinetobacter baumannii Strains Isolated From Hospitalized Patients in Shahid Motahari Burn Hospital, Tehran, Iran. Jundishapur J Microbiol. 2015; 8(10) : 19048 [DOI][PubMed]

  • 25.

    Vakili B, Khorvash F, Fazeli H, Khaleghi M. Detection of quinolone-resistance mutations of parC gene in clinical isolates of Acinetobacter baumannii in Iran. J Res Med Sci. 2014; 19(6) : 567 -70 [PubMed]

  • 26.

    Srinivasan VB, Rajamohan G, Pancholi P, Stevenson K, Tadesse D, Patchanee P, et al. Genetic relatedness and molecular characterization of multidrug resistant Acinetobacter baumannii isolated in central Ohio, USA. Ann Clin Microbiol Antimicrob. 2009; 8 : 21 [DOI][PubMed]

  • 27.

    Asadollahi P, Akbari M, Soroush S, Taherikalani M, Asadollahi K, Sayehmiri K, et al. Antimicrobial resistance patterns and their encoding genes among Acinetobacter baumannii strains isolated from burned patients. Burns. 2012; 38(8) : 1198 -203 [DOI][PubMed]

  • 28.

    Antunes LC, Visca P, Towner KJ. Acinetobacter baumannii: evolution of a global pathogen. Pathog Dis. 2014; 71(3) : 292 -301 [DOI][PubMed]

  • 29.

    Adams-Haduch JM, Paterson DL, Sidjabat HE, Pasculle AW, Potoski BA, Muto CA, et al. Genetic basis of multidrug resistance in Acinetobacter baumannii clinical isolates at a tertiary medical center in Pennsylvania. Antimicrob Agents Chemother. 2008; 52(11) : 3837 -43 [DOI][PubMed]

  • 30.

    Golanbar GD, Lam CK, Chu YM, Cueva C, Tan SW, Silva I, et al. Phenotypic and molecular characterization of Acinetobacter clinical isolates obtained from inmates of California correctional facilities. J Clin Microbiol. 2011; 49(6) : 2121 -31 [DOI][PubMed]

  • 31.

    Ribera A, Ruiz J, Jiminez de Anta MT, Vila J. Effect of an efflux pump inhibitor on the MIC of nalidixic acid for Acinetobacter baumannii and Stenotrophomonas maltophilia clinical isolates. J Antimicrob Chemother. 2002; 49(4) : 697 -8 [PubMed]

  • 32.

    Coban AY, Guney AK, Tanriverdi Cayci Y, Durupinar B. Effect of 1-(1-Naphtylmethyl)-piperazine, an efflux pump inhibitor, on antimicrobial drug susceptibilities of clinical Acinetobacter baumannii isolates. Curr Microbiol. 2011; 62(2) : 508 -11 [DOI][PubMed]

  • 33.

    Ardebili A, Lari AR, Talebi M. Correlation of ciprofloxacin resistance with the AdeABC efflux system in Acinetobacter baumannii clinical isolates. Ann Lab Med. 2014; 34(6) : 433 -8 [DOI][PubMed]

  • 34.

    Touati A, Brasme L, Benallaoua S, Gharout A, Madoux J, De Champs C. First report of qnrB-producing Enterobacter cloacae and qnrA-producing Acinetobacter baumannii recovered from Algerian hospitals. Diagn Microbiol Infect Dis. 2008; 60(3) : 287 -90 [DOI][PubMed]

  • 35.

    Hujer KM, Hujer AM, Hulten EA, Bajaksouzian S, Adams JM, Donskey CJ, et al. Analysis of antibiotic resistance genes in multidrug-resistant Acinetobacter sp. isolates from military and civilian patients treated at the Walter Reed Army Medical Center. Antimicrob Agents Chemother. 2006; 50(12) : 4114 -23 [DOI][PubMed]

  • 36.

    Wisplinghoff H, Decker M, Haefs C, Krut O, Plum G, Seifert H. Mutations in gyrA and parC associated with resistance to fluoroquinolones in epidemiologically defined clinical strains of Acinetobacter baumannii. J Antimicrobial Chemo. 2003; 51(1) : 80 -177

  • COMMENTS

    LEAVE A COMMENT HERE: