Emergence of blaOXA-Carrying Carbapenem Resistance in Multidrug-Resistant Acinetobacter baumannii in the Intensive Care Unit

AUTHORS

Sareh Bagheri Josheghani 1 , Rezvan Moniri 1 , * , Farzaneh Firoozeh 1 , Mojtaba Sehat 2 , Kamran Dastehgoli 3 , Hasan Koosha 4 , Reza Khaltabadi Farahani 5

1 Department of Microbiology and Immunology, Faculty of Medicine, Kashan University of Medical Sciences, Kashan, IR Iran

2 Trauma Research Center, Kashan University of Medical Sciences, Kashan, IR Iran

3 Anatomical Sciences Research Center, Kashan University of Medical Sciences, Kashan, IR Iran

4 Shahid Beheshti Hospital, Kashan University of Medical Sciences, Kashan, IR Iran

5 National Center for Diagnosis, Reference Laboratory of Veterinary and Applied Studies, Tehran, IR Iran

How to Cite: Bagheri Josheghani S, Moniri R, Firoozeh F, Sehat M, Dastehgoli K, et al. Emergence of blaOXA-Carrying Carbapenem Resistance in Multidrug-Resistant Acinetobacter baumannii in the Intensive Care Unit, Iran Red Crescent Med J. 2017 ; 19(5):e27327. doi: 10.5812/ircmj.27327.

ARTICLE INFORMATION

Iranian Red Crescent Medical Journal: 19 (5); e27327
Published Online: June 13, 2016
Article Type: Research Article
Received: January 25, 2015
Accepted: February 7, 2015
Crossmark

Crossmark

CHEKING

READ FULL TEXT
Abstract

Background: Emergence of multidrug-resistant (MDR) Acinetobacter baumannii infections is becoming a worldwide threat to hospitalized patients, particularly in intensive care units.

Objectives: The aim of this study was to investigate the antimicrobial susceptibility patterns and prevalence of blaOXA-type carbapenemases of A. baumannii isolates in a teaching hospital in Iran.

Patients and Methods: The study included a total of 40 isolates of carbapenem-resistant A. baumannii, obtained from 103 tracheal tubes in hospitalized ICU patients. Antimicrobial susceptibility testing was performed according to CLSI guidelines. The blaOXA-51, blaOXA-23, blaOXA-24, blaOXA-58, and ISAba1 genes were detected by PCR.

Results: All of the A. baumannii isolates were resistant to imipenem and meropenem, and 100% of the isolates were MDR. The blaOXA-51 and ISAba1 genes were detected in 100% of the isolates. blaOXA-23 and blaOXA-24 were detected in 90% and 40% of the isolates, respectively, but blaOXA-58 was absent in the A. baumannii isolates. In addition, 32.5% of carbapenem-resistant strains contained at least three genes encoding blaOXA-type carbapenemase. Colistin and polymyxin B were the most effective antibiotics. The sole risk factor for infection of hospitalized patients with carbapenem-resistant Acinetobacter strains was age over 40 years (P = 0.042). The mortality rate was 27.5%.

Conclusions: These findings signify the alarming spread of OXA genes in A. baumannii strains in our intensive care unit. The spread of carbapenem-resistant Acinetobacter strains has serious health implications and requires the application of strict infection-control measures.

Keywords

Carbapenem Antibiotic Resistance Intensive Care Unit Acinetobacter baumannii

Copyright © 2016, Iranian Red Crescent Medical Journal. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

1. Background

Multidrug-resistant (MDR) Acinetobacter baumannii has been identified as an important worldwide cause of nosocomial infections. Ventilation-associated pneumonia (VAP) caused by A. baumannii is primarily an opportunistic nosocomial infection, mainly acquired in intensive care units (ICUs) (1). VAP is associated with an extensive morbidity rate due to the increased length of ICU stay and prolonged mechanical ventilation (2, 3). Carbapenems have been used as the most appropriate choice for treatment of infections due to MDR strains of A. baumannii. Unfortunately, the prevalence of carbapenem-resistant isolates is increasing (4). Since carbapenems play a vital role in the treatment of nosocomial infections caused by A. baumannii, evaluation of the sensitivity rate of A. baumannii to carbapenem is crucial for proper antibiotic therapy and for preventing the emergence of MDR strains (5). Extensive administration of broad-spectrum cephalosporins and/or carbapenems is a significant risk factor for development of colonization or infection with carbapenemase-producing A. baumannii.

Four types of eight known clusters of OXA-type carbapenemases have been identified in A. baumannii: blaOXA-23-like, blaOXA-24, blaOXA-58, and blaOXA-51 (6, 7). The genes encoding the blaOXA-51 and blaOXA-23 enzymes have been found to be adjacent to ISAba1, suggesting that ISAba1 provides the promoter for these genes (8). The higher carbapenem hydrolysis rates may occur due to acquisition of the ISAba1 element upstream of the blaOXA-51 gene (9). Carbapenemase-producing A. baumannii may lead to clinical infections or asymptomatic colonization (10). Patients infected or colonized with carbapenemase-producing A. baumannii should be placed under contact protection. Screening of high-risk patients to detect colonization may also be helpful in controlling transmission.

2. Objectives

The aim of this study was to investigate carbapenem susceptibility rates and a determination of the four subgroups of OXA carbapenemase in carbapenem-resistant A. baumannii isolates from the tracheal tubes of patients in the ICU.

3. Patients and Methods

3.1. Sample Collection

This cross-sectional study was performed at Beheshti Hospital, a tertiary care center in Kashan, Iran, from October 2012 to March 2014. The ethics committee of Kashan University of Medical Sciences approved the study protocol. The specimens were collected from the tracheal tubes of patients hospitalized in the ICU. The A. baumannii strains were isolated and identified by using Microgen® GNA (Microgen Bioproducts Co., UK).

3.2. Determination of Antibiotic Resistance

Antibiotic susceptibility of the isolates was determined with imipenem, meropenem, piperacillin, ampicillin-sulbactam, piperacillin-tazobactam, ceftazidime, cefepime, cefotaxime, ceftriaxone, amikacin, gentamicin, levofloxacin, ciprofloxacin, tetracycline, trimethoprim-sulfamethoxazole, colistin, and polymyxin B disks (MAST, Merseyside, UK), using the Kirby-Bauer disk-diffusion breakpoint assay on Mueller-Hinton agar (Merck, Germany). Bacteria were classified as susceptible, intermediate, or resistant, according to the Clinical Laboratory Standard Institute (CLSI) recommendations (11). Escherichia coli ATCC 25922 was used as a quality control for each susceptibility test. The DNA extraction was performed from fresh cultures using boiling techniques, and stored at 4°C until PCR amplification was performed.

3.3. PCR Amplification of the Carbapenemase-Encoding Gene

All primers used in this study are listed in Table 1. The primers used for these tests were purchased from Bioneer Co. (Korea). All isolates were subjected to multiplex PCR to detect the blaOXA-51, blaOXA-23, blaOXA-24, and blaOXA-58 genes. The ISAba1 element was identified using the primers as described in a previous study (10). The thermocycler (Eppendorf, Hamburg, Germany) was programmed at 94°C for 5 minutes, followed by 30 cycles of 25 seconds at 94°C, 40 seconds at 53°C, and 50 seconds at 72°C, with a final cycle of 6 minutes at 72°C (12).

Table 1. Primers Used in This Study for Amplification of Genes from A. baumannii Isolates
PrimerNucleotide Sequence (5’ to 3’)Amplicon Size (bp)Annealing (°C)Reference
OXA51LFTAA TGC TTT GAT CGG CCT TG35353(12)
OXA51LRTGG ATT GCA CTT CAT CTT GG
OXA23LFGAT CGG ATT GGA GAA CCA GA50153(12)
OXA23LRATT TCT GAC CGC ATT TCC AT
OXA24LFGGT TAG TTG GCC CCC TTA AA24653(12)
OXA24LRAGT TGA GCG AAA AGG GGA TT
OXA58LFAAGTATTGGGGCTTGTGCTG59953(12)
OXA58LRCCCCTCTGCGCTCTACATAC
ISAba1FCACGAATGCAGAAGTTG54956(8)
ISAba1RCGACGAATACTATGACAC

The amplification conditions to detect ISAba1 were as follows: initial denaturation at 95°C for 5 minutes, 35 cycles of 95°C for 45 seconds, 56°C for 45 seconds, 72°C for 3 minutes, and a final elongation at 72°C for 5 minutes (8). PCR products were set on 1.0% agarose gels, stained with ethidium bromide, and photographed by UV illumination (Ingenius, Syngene). The sizes of the PCR products were compared with a 100-bp DNA ladder (Bioneer, Korea). A. baumannii ATCC 19606 was used as the reference strain.

Sequencing of the blaOXA-type β-lactamase genes was also performed. BLAST was used for sequence analysis.

3.4. Statistical Analysis

The statistical analysis was performed with SPSS (version 19, Chicago, IL, USA). The Chi-square test or Fisher’s exact test was used to compare proportions. P values of < 0.05 were considered statistically significant.

4. Results

The mean age of the studied patients was 53.88 ± 22.62 years. Fifty-three of the 103 enrolled patients in this study were male (51.5%). A. baumannii was isolated from 38.8% of the patients (40 out of 103). The other isolated microorganisms in this study were as follows: S. aureus (12.6%), Klebsiella spp. (11.7%), Staphylococcus coagulase-negative (9.7%), Pseudomonas aeruginosa (8.7%), E. coli (3.9%), Citrobacter and Enterobacter (each 2.9%), Enterococcus (1.9%), and Streptococcus pyogenes (1%). The median length of hospitalization was 38.1 days (SD: 24.53), and the median length of ICU stay was 30 days. The maximum and minimum lengths of hospitalization were 98 days and 2 days, respectively. The duration of hospitalization in Acinetobacter-positive patients increased to 9.8 days after adjusting for sex and age. In the unadjusted model, the duration of hospitalization decreased to 9.48 days. The characteristics of the patients are summarized in Table 2. The mortality rate for Acinetobacter-positive ICU patients was 27.5% (11 out of 40). The average age at death was 61.5 ± 23.8 years.

Table 2. Demographic Characteristics of the Study Population
ParameterNo. (%) of PatientsMean ± SD (Range[Min, Max])P Value
A. baumannii (n = 40)Other (n = 63)A. baumanniiOther
Age (yrs)0.042
≤ 4012 (30)31 (49.2)57.25 ± 20.7651.75 ± 23.63
4028 (70)32 (50.8)(70 [25,95])(92 [5,97])
Length of hospital stay (days)0.247
≤ 3018 (45)34 (54)43.9±22.7834.41±25.07
3022 (55)29 (46)(87 [11,98])(182 [2,184])
Sex (male/female)18/2235/280.200
Death ratio11/2910/530.120

The frequency rates of antibiotic resistance patterns of the 40 carbapenem-resistant A. baumannii strains are shown in Table 3. All of the isolates were resistant to at least three classes of antibiotics (MDR). All of the A. baumannii isolates from the ICU were resistant to imipenem and meropenem. Colistin and polymyxin B remained the most effective studied antibiotics. Unfortunately, all of the isolated A. baumannii strains were resistant to piperacillin, piperacillin-tazobactam, ceftazidime, cefepime, cefotaxime, ceftriaxone, meropenem, imipenem, ciprofloxacin, levofloxacin, and trimethoprim-sulfamethoxazole. The highest rates of resistance were observed for tetracycline (92.5%), ampicillin-sulbactam (90%), amikacin (87.5%), and gentamicin (82.5%). The PCR results based on the β-lactamase gene are shown in Table 4. The A. baumannii isolates were 100% positive for the blaOXA-51 and ISAba1 genes, 90% positive for the blaOXA-23 gene, and 40% positive for the blaOXA-24 gene. None were positive for blaOXA-58.

Table 3. Antimicrobial Susceptibility of 40 Carbapenem-Resistant A. baumannii Isolatesa
No.PRLSAMPTZCAZCPMCTXCROMEMIMIAKGMLEVCIPTTSCOPB
1RRRRRRRRRRRRRRRSS
2RRRRRRRRRRRRRRRSS
3RRRRRRRRRRRRRRRSS
4RRRRRRRRRSRRRRRSS
5RIRRRRRRRRRRRIRSS
6RRRRRRRRRRRRRRRSS
7RRRRRRRRRRRRRRRSS
8RRRRRRRRRRRRRRRSS
9RRRRRRRRRRRRRRRSS
10RRRRRRRRRRRRRRRSS
11RRRRRRRRRRRRRRRSS
12RRRRRRRRRRRRRRRSS
13RIRRRRRRRIRRRRRSS
14RRRRRRRRRRRRRRRSS
15RRRRRRRRRRRRRRRSS
16RRRRRRRRRRRRRRRSS
17RRRRRRRRRRRRRRRSS
18RRRRRRRRRSSRRRRSS
19RRRRRRRRRRRRRRRSS
20RRRRRRRRRRRRRRRSS
21RRRRRRRRRRRRRRRSS
22RIRRRRRRRRSRRRRSS
23RRRRRRRRRRRRRRRSS
24RRRRRRRRRRRRRRRSS
25RRRRRRRRRRRRRRRSS
26RSRRRRRRRRRRRRRSS
27RRRRRRRRRRRRRRRSS
28RRRRRRRRRRRRRRRSS
29RRRRRRRRRRRRRRRSS
30RRRRRRRRRRIRRRRSS
31RRRRRRRRRRRRRRRSS
32RRRRRRRRRIRRRRRSS
33RRRRRRRRRRSRRRRSS
34RRRRRRRRRRSRRIRSS
35RRRRRRRRRRRRRRRSS
36RRRRRRRRRRSRRIRSS
37RRRRRRRRRRRRRRRSS
38RRRRRRRRRRSRRRRSS
39RRRRRRRRRIRRRRRSS
40RRRRRRRRRRRRRRRSS

aAbbriviations: AK: amikacin; CAZ: ceftazidime; CIP: ciprofloxacin; CO: colistin; CPM: cefepime; CRO: ceftriaxone; CTX: cefotaxime; GM: gentamicin; I: intermediate; IMI: imipenem; LEV: levofloxacin; MEM: meropenem; PB: polymyxin B; PRL: piperacillin; S: susceptible; PTZ: piperacillin-tazobactam; R: resistant; SAM: ampicillin-sulbactam; T: tetracycline, TS: trimethoprim-sulfamethoxazole.

Table 4. PCR Results Based on β-lactamase Gene
No. (%)blaOXA-23No. (%)blaOXA-24No. (%)blaOXA-51No. (%)blaoxa-58no. (%)ISAba1No. (%)
23 (57.5)+++
3 (7.5)+++
13 (32.5)++++
Total40 (100)0 (0)40 (100)16 (40)36 (90)

Analysis of the incidence of the OXA-encoding gene in the ICU isolates demonstrated that the majority of the strains, 23 out of 40 (57.5%), were simultaneously positive for the blaOXA-51 and blaOXA-23 genes, although 3 out of 40 isolates (7.5%) had both blaOXA-51 and blaOXA-24 genes. In addition, 13 out of 40 isolates (32.5%) had the blaOXA-51, blaOXA-23, and blaOXA-24 genes simultaneously.

The resistance rate of A. baumannii to imipenem and meropenem in Iran is shown in Figure 1.

Distribution of Carbapenem Resistance of A. baumannii in Iran (2005-2014)
Figure 1. Distribution of Carbapenem Resistance of A. baumannii in Iran (2005-2014)

5. Discussion

A. baumannii is an important cause of nosocomial infections in many hospitals around the world, which complicates both treatment and control, due to its prolonged environmental survival time and its ability to develop resistance to multiple antimicrobial agents. A. baumannii infections mainly occur in special individuals with various risk factors, such as mechanical ventilation, hospitalization in the ICU, and a previous history of antibiotic therapy, chiefly with broad-spectrum types, such as third-generation cephalosporins and carbapenems. A. baumannii has a tendency to develop antimicrobial resistance very quickly, causing severe therapeutic problems. Carbapenems are frequently the antibiotic of choice for the treatment of serious infections. The results of the present study show that there was an extreme increase at our hospital in the resistance rate of A. baumannii to imipenem, which is the drug of choice, from 25% in 2008 to 100% in 2014 (13). In addition, the resistance rate of A. baumannii to meropenem was 100%, which is higher than in previous reports in Iran (14-20). The present study showed low susceptibility rates of the most clinically applicable antibiotics for the treatment of infections caused by A. baumannii, except for polymyxin B and colistin, which may be used as the final options in the management of infections caused by this bacterium. In this study, the high resistance rate of A. baumannii against carbapenems may indicate the outcome of overuse and misuse of carbapenems in our hospital. Several studies on A. baumannii in different parts of the world have also shown huge drug-resistance rates; for example, there is 70% resistance to imipenem in Egypt, 64.3% resistance to meropenem in Nigeria, 32.6% resistance to carbapenem in Saudi Arabia, and 17.6% resistance to imipenem in Chinese hospitals (21-24). Variations in reports between the studies could be influenced by ecological factors and different administration of antimicrobial plans.

Multiple mechanisms are reported for carbapenem resistance in A. baumannii, including active efflux of drugs, enzymatic inactivation, and modification of target sites. The results of our study showed that all carbapenem-resistant A. baumannii were positive for the blaOXA-51 gene. Similar results were reported by Heritier et al., Woodford et al., and Taherikalani et al. (5, 25, 26). The present study confirmed a previous report that detection of blaOXA-51 can be used as a reliable way to identify A. baumannii (27). Bali et al. reported that 77% of carbapenem-resistant Acinetobacter isolates elaborated blaOXA-23 and blaOXA-51 genes in a temperate northern Indian state (28). Mohajeri et al. reported that 100% of the Acinetobacter isolates from the western part of Iran were positive for blaOXA-51, 77.9% for blaOXA-23, and 19.2% for blaOXA-24, but none were positive for blaOXA-58. They also stated that blaOXA-23 was the predominant gene, which is similar to the results of the present study (16). The blaOXA-23 + blaOXA-51 combination was predominant between the carbapenem-resistant isolates in our study. blaoxa-23, blaOXA-24, and the combination of these two genes were always associated with resistance or at least with reduced susceptibility to antibiotics (29).

The results of this study showed that 12 isolates that contained the blaOXA-51, blaOXA-23, and blaOXA-24 genes had MDR to carbapenems, broad-spectrum cephalosporins, aminoglycosides, ampicillin/sulbactam, piperacillin-tazobactam, tetracycline, trimethoprim-sulfamethoxazole, and ciprofloxacin. The blaOXA-58 gene is an extensively spread carbapenem-hydrolyzing class D β-lactamase that has been reported in A. baumannii isolates from France, Argentina, Kuwait, the United States, and many Asian-Pacific nations (30-33). This gene can hydrolyze penicillins, oxacillin, and imipenem, but is not able to hydrolyze expanded-spectrum cephalosporins. The blaOXA-58 gene was not isolated in our study. In previous studies, carbapenem resistance was associated only with isolates in which ISAba1 was upstream of blaOXA-51. blaOXA-51 chromosomally encoded enzymes are intrinsic for A. baumannii (9). In this study, all 40 carbapenem-resistant isolates were PCR positive for ISAba1. It has been reported that possession of the ISAba1-encoded gene increases the hydrolysis of carbapenems (24). Recently, the significance of ISAba1 for carbapenem resistance caused by OXAs in A. baumannii has been described many times (34).

The presence of class D carbapenemase-encoding genes within mobile elements, as well as the genetic potential of A. baumannii for acquiring foreign DNA from the environment, facilitates the distribution of resistant isolates and/or resistance genes in the ICU. These findings also provide strong evidence that the ICU environment has become the major reservoir of these resistance genes, which may help in the DNA exchange among nosocomial pathogens. Proper implementation of infection-control procedures and introduction of a sophisticated antibiotic therapy policy is suggested. This study demonstrated a high distribution of carbapenemase-encoding genes, mainly blaOXA-23, in A. baumannii isolates in the ICU, while blaOXA-24 was less common. Polymyxin B and colistin were the most active antimicrobial agents tested. A. baumannii infections associated with mechanical ventilation frequently develop as nosocomial infections, and are associated with a high mortality rate. The need for mechanical ventilation, and infection with carbapenem-resistant strains, were risk factors associated with a higher mortality rate in patients with A. baumannii infections in our study.

Acknowledgements

Footnotes

References

  • 1.

    Gadani H, Vyas A, Kar AK. A study of ventilator-associated pneumonia: Incidence, outcome, risk factors and measures to be taken for prevention. Indian J Anaesth. 2010; 54(6) : 535 -40 [DOI][PubMed]

  • 2.

    Lambiase A, Rossano F, Piazza O, Del Pezzo M, Catania MR, Tufano R. Typing of Pseudomonas aeruginosa isolated from patients with VAP in an intensive care unit. New Microbiol. 2009; 32(3) : 277 -83 [PubMed]

  • 3.

    Bergmans DC, Bonten MJ, Gaillard CA, Paling JC, van der Geest S, van Tiel FH, et al. Prevention of ventilator-associated pneumonia by oral decontamination: a prospective, randomized, double-blind, placebo-controlled study. Am J Respir Crit Care Med. 2001; 164(3) : 382 -8 [DOI][PubMed]

  • 4.

    Kluytmans-Vandenbergh MF, Kluytmans JA, Voss A. Dutch guideline for preventing nosocomial transmission of highly resistant microorganisms (HRMO). Infection. 2005; 33(5-6) : 309 -13 [DOI][PubMed]

  • 5.

    Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents. 2006; 27(4) : 351 -3 [DOI][PubMed]

  • 6.

    Walther-Rasmussen J, Hoiby N. Class A carbapenemases. J Antimicrob Chemother. 2007; 60(3) : 470 -82 [DOI][PubMed]

  • 7.

    Brown S, Amyes S. OXA (beta)-lactamases in Acinetobacter: the story so far. J Antimicrob Chemother. 2006; 57(1) : 1 -3 [DOI][PubMed]

  • 8.

    Segal H, Garny S, Elisha BG. Is IS(ABA-1) customized for Acinetobacter? FEMS Microbiol Lett. 2005; 243(2) : 425 -9 [DOI][PubMed]

  • 9.

    Turton JF, Ward ME, Woodford N, Kaufmann ME, Pike R, Livermore DM, et al. The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol Lett. 2006; 258(1) : 72 -7 [DOI][PubMed]

  • 10.

    Wroblewska MM, Towner KJ, Marchel H, Luczak M. Emergence and spread of carbapenem-resistant strains of Acinetobacter baumannii in a tertiary-care hospital in Poland. Clin Microbiol Infect. 2007; 13(5) : 490 -6 [DOI][PubMed]

  • 11.

    Wikler MA. Performance standards for antimicrobial susceptibility testing: Twentieth informational supplement. 2013;

  • 12.

    Feizabadi MM, Fathollahzadeh B, Taherikalani M, Rasoolinejad M, Sadeghifard N, Aligholi M, et al. Antimicrobial susceptibility patterns and distribution of blaOXA genes among Acinetobacter spp. Isolated from patients at Tehran hospitals. Jpn J Infect Dis. 2008; 61(4) : 274 -8 [PubMed]

  • 13.

    Moniri R, Farahani RK, Shajari G, Shirazi MN, Ghasemi A. Molecular epidemiology of aminoglycosides resistance in acinetobacter spp. With emergence of multidrug-resistant strains. Iran J Public Health. 2010; 39(2) : 63 -8 [PubMed]

  • 14.

    Safari M, Saidijam M, Bahador A, Jafari R, Alikhani MY. High prevalence of multidrug resistance and metallo-beta-lactamase (MbetaL) producing Acinetobacter baumannii isolated from patients in ICU wards, Hamadan, Iran. J Res Health Sci. 2013; 13(2) : 162 -7 [PubMed]

  • 15.

    Talebi TM, Latifnia M, Moosavai SAJ, Adabi M, Sh B. Risk factors and antimicrobial susceptibility in ventilator associated pneumonia: A brief report. Tehran Univ Med Scie. 2012; 70(9) : 577 -82

  • 16.

    Mohajeri P, Farahani A, Feizabadi MM, Ketabi H, Abiri R, Najafi F. Antimicrobial susceptibility profiling and genomic diversity of Acinetobacter baumannii isolates: A study in western Iran. Iran J Microbiol. 2013; 5(3) : 195 -202 [PubMed]

  • 17.

    Amini M, Davati A, Golestanifard M. Frequency of nosocomial infections with antibiotic resistant strains of acinetobacterspp. In icu patient. Iranian J Pathol. 2012; 7(4) : 241 -5

  • 18.

    Japoni S, Farshad S, Abdi Ali A, Japoni A. Antibacterial susceptibility patterns and cross-resistance of acinetobacter, isolated from hospitalized patients, southern iran. Iran Red Crescent Med J. 2011; 13(11) : 832 -6 [PubMed]

  • 19.

    Khosrishahi N, Sharifi M. Isolation of carbapenem resistant acinetobacter baumannii (crab) strains from patients and equipments of intensive care units (icus) at qazvin between 2005-2006. Iranian J Med Microbiol. 2007; 1(3) : 33 -8

  • 20.

    Karbasizade V, Heidari L. Antimicrobial resistance of acinetobacter baumannii isolated from intensive care units of isfahan hospitals, iran. J Isfahan Med Sch. 2012; 30(191)

  • 21.

    Al-Agamy MH, Khalaf NG, Tawfick MM, Shibl AM, El Kholy A. Molecular characterization of carbapenem-insensitive Acinetobacter baumannii in Egypt. Int J Infect Dis. 2014; 22 : 49 -54 [DOI][PubMed]

  • 22.

    Nwadike VU, Ojide CK, Kalu EI. Multidrug resistant acinetobacter infection and their antimicrobial susceptibility pattern in a nigerian tertiary hospital icu. Afr J Infect Dis. 2013; 8(1) : 14 -8 [DOI]

  • 23.

    Al Johani SM, Akhter J, Balkhy H, El-Saed A, Younan M, Memish Z. Prevalence of antimicrobial resistance among gram-negative isolates in an adult intensive care unit at a tertiary care center in Saudi Arabia. Ann Saudi Med. 2010; 30(5) : 364 -9 [DOI][PubMed]

  • 24.

    Zhou H, Pi BR, Yang Q, Yu YS, Chen YG, Li LJ, et al. Dissemination of imipenem-resistant Acinetobacter baumannii strains carrying the ISAba1 blaOXA-23 genes in a Chinese hospital. J Med Microbiol. 2007; 56 : 1076 -80 [DOI][PubMed]

  • 25.

    Heritier C, Poirel L, Fournier PE, Claverie JM, Raoult D, Nordmann P. Characterization of the naturally occurring oxacillinase of Acinetobacter baumannii. Antimicrob Agents Chemother. 2005; 49(10) : 4174 -9 [DOI][PubMed]

  • 26.

    Taherikalani M, Fatolahzadeh B, Emaneini M, Soroush S, Feizabadi MM. Distribution of different carbapenem resistant clones of Acinetobacter baumannii in Tehran hospitals. New Microbiol. 2009; 32(3) : 265 -71 [PubMed]

  • 27.

    Brown S, Young HK, Amyes SG. Characterisation of OXA-51, a novel class D carbapenemase found in genetically unrelated clinical strains of Acinetobacter baumannii from Argentina. Clin Microbiol Infect. 2005; 11(1) : 15 -23 [DOI][PubMed]

  • 28.

    Bali NK, Fomda BA, Bashir H, Zahoor D, Lone S, Koul PA. Emergence of carbapenem-resistant Acinetobacter in a temperate north Indian State. Br J Biomed Sci. 2013; 70(4) : 156 -60 [PubMed]

  • 29.

    Dalla-Costa LM, Coelho JM, Souza HA, Castro ME, Stier CJ, Bragagnolo KL, et al. Outbreak of carbapenem-resistant Acinetobacter baumannii producing the OXA-23 enzyme in Curitiba, Brazil. J Clin Microbiol. 2003; 41(7) : 3403 -6 [PubMed]

  • 30.

    Poirel L, Marque S, Heritier C, Segonds C, Chabanon G, Nordmann P. OXA-58, a novel class D {beta}-lactamase involved in resistance to carbapenems in Acinetobacter baumannii. Antimicrob Agents Chemother. 2005; 49(1) : 202 -8 [DOI][PubMed]

  • 31.

    Coelho J, Woodford N, Afzal-Shah M, Livermore D. Occurrence of OXA-58-like carbapenemases in Acinetobacter spp. collected over 10 years in three continents. Antimicrob Agents Chemother. 2006; 50(2) : 756 -8 [DOI][PubMed]

  • 32.

    Castanheira M, Wanger A, Kruzel M, Deshpande LM, Jones RN. Emergence and clonal dissemination of OXA-24- and OXA-58-producing Acinetobacter baumannii strains in Houston, Texas: report from the SENTRY Antimicrobial Surveillance Program. J Clin Microbiol. 2008; 46(9) : 3179 -80 [DOI][PubMed]

  • 33.

    Mendes RE, Bell JM, Turnidge JD, Castanheira M, Jones RN. Emergence and widespread dissemination of OXA-23, -24/40 and -58 carbapenemases among Acinetobacter spp. in Asia-Pacific nations: report from the SENTRY Surveillance Program. J Antimicrob Chemother. 2009; 63(1) : 55 -9 [DOI][PubMed]

  • 34.

    Nowak P, Paluchowska P, Budak A. Distribution of blaOXA genes among carbapenem-resistant Acinetobacter baumannii nosocomial strains in Poland. New Microbiol. 2012; 35(3) : 317 -25 [PubMed]

  • COMMENTS

    LEAVE A COMMENT HERE: