IF: 0.644
REUTERS THOMSON

Effect of a Neoflavonoid (Dalbergin) on T47D Breast Cancer Cell Line and mRNA Levels of p53, Bcl-2, and STAT3 Genes

AUTHORS

Fereshte Mahdizade Valojerdi 1 , Bahram Goliaei 2 , * , Kazem Parivar 1 , Alireza Nikoofar 3

AUTHORS INFORMATION

1 Department of Biology, Sciences and Research Branch, Islamic Azad University, Tehran, Iran

2 Department of Biophysics, Institute of Biochemistry and Biophysics, University of Tehran, Tehran, Iran

3 Department of Radiotherapy, Iran University of Medical Sciences, Tehran, Iran

ARTICLE INFORMATION

Iranian Red Crescent Medical Journal: 21 (4); e87175
Published Online: May 11, 2019
Article Type: Research Article
Received: December 8, 2018
Revised: March 27, 2019
Accepted: March 29, 2019
Crossmark

Crossmark

CHEKING

READ FULL TEXT
Abstract

Background: Breast cancer is an important cause of death among women. Prevention of cancer through dietary intervention has recently received increasing interest. Lately, dietary polyphenols have gained much attention for their health benefits, including anticancer properties. Dalbergin as a polyphenol is synthesized from a common neoflavene intermediate.

Objectives: This study aimed to examine whether dalbergin can be useful in the chemotherapy of estrogen receptor-positive T47D cell line.

Methods: This experimental study was performed at the Laboratory of Biophysics and Molecular Biology, the Institute of Biochemistry and Biophysics, University of Tehran, Tehran, Iran, from October 2017 to November 2019. The doubling time of T47D cells was obtained from the growth curve. The cytotoxic effect of dalbergin on T47D breast cancer cells was evaluated. To assess the clonogenic ability, T47D cells were treated with dalbergin for 48 hours and then, the colony assay was performed. A Real-Time PCR was used to determine the transcription levels of p53, Bcl-2, and STAT3 genes.

Results: The doubling time of T47D cells was 28.02 ± 4.22 hours (P < 0.05). Dalbergin decreased the viability of the T47D cell line. The half-maximal inhibitory concentration (IC50) values of dalbergin for T47D cells were found to be 1 µM in 24 hours, 0.001 µM in 48 hours, and 0.00001 µM in 72 hours of treatment (P < 0.05). In the clonogenic assay, 0.001 µM dalbergin for 48 hours could reduce the surviving fraction of T47D cells (P < 0.05). Additionally, dalbergin could change the mRNA levels of p53, Bcl-2, and STAT3 genes (P < 0.05).

Conclusions: Our results indicated that dalbergin has some anticancer effects probably through inducing apoptosis in cancerous cells by changing mRNA levels of apoptosis-related proteins.

Keywords

Anti-Cancer Apoptosis Breast Neoplasms Cell Line Dalbergin Estrogen Genes Humans Receptors T47D Tumor Suppressor Protein p53

Copyright © 2019, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited
1. Background

Breast cancer is quite prevalent and is the leading cause of cancer-related death among women worldwide (1, 2). Breast cancer cell lines have been used widely to investigate the pathobiology of cancer and new therapies (3). Chemotherapy uses drugs to kill cancer cells (4). Polyphenols are a group of common substances found in most plants that possess diverse biological features. They play an important role in suppressing carcinogenesis by targeting proteins involved in cell signaling pathways (5). Recent studies have indicated that natural polyphenols can enhance chemotherapy with minimal toxicity to normal cells (6). Neoflavonoids are a class of polyphenolic compounds that have the 4-phenylchromen backbone with no hydroxyl group substitution at position-2, unlike flavonoids that have the 2-phenylchromen-4-one backbone. Several studies have reported neoflavonoids to possess antioxidant, anticancer, nitric oxide reduction, and anti-inflammatory activities (7).

The species of plant Dalbergia have been applied in traditional medicine as a remedy for blood disorders, ischemia, and inflammation. Neoflavonoids, belonging to the neoflavene family, were initially isolated from Dalbergia sissoo and Dalbergia latifolia (8, 9). This polyphenol has shown to have anticancer effects in different tumor cell lines; however, it shows differential cytotoxic activity against tumor and surrounding normal cells (10). Nevertheless, it has not reported whether dalbergin induces apoptotic cell death. This programmed cell death has been implicated in many diseases including cancer and autoimmune diseases. Therefore, it is very important to understand the mode of cell death (11, 12). The p53 gene is a kind of regulatory factor for tissue apoptosis. In about 50% of cancers, p53 is subjected to mutations (13). Specifically, improper STAT3 activity has been detected in a wide variety of tumors (14), deriving multiple pro-oncogenic functions. Bcl-2 is the first apoptotic regulatory protein that has ever been recognized. This oncoprotein is activated via chromosome translocation in human follicular lymphoma. Over-expression of Bcl-2 and its close relatives has been noticed as significant components of chemo-resistance (15).

In this study, we examined the effect of dalbergin on the estrogen receptor-positive T47D breast cancer cell line by analyzing its clonogenic ability. We also determined whether dalbergin-induced cell death is correlated with the up-regulation of apoptosis-modulating genes, especially p53, Bcl-2, and STAT3 genes. The pharmacological effects of dalbergin in T47D have not been reported yet. This study investigated whether dalbergin can mediate its anti-proliferative and apoptotic effects in T47D cells through the suppression of p53, Bcl-2, and STAT3 pathway.

2. Objectives

Therefore, the current study was designed to determine how dalbergin could affect the T47D breast cancer cell line and disclose its effects on apoptosis and survival of the T47D cell line.

3. Methods

This experimental study was conducted at the Laboratory of Biophysics and Molecular Biology, the Institute of Biochemistry and Biophysics, University of Tehran, Tehran, Iran, from October 2017 to November 2019. The study was financially supported by the Research Deputy of the Science and Research Branch, Tehran Islamic Azad University, Tehran, Iran.

3.1. Materials

Dalbergin was obtained from ABCR GmbH (Germany). Dimethylsulfoxide (DMSO), formaldehyde, crystal violet, and Trypsin were purchased from Merck (Germany). Trypan blue, methyl green, Penicillin, and (3-(4, 5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were provided from Sigma- Aldrich (USA). Cell culture media (RPMI-1640) and fetal bovine serum were purchased from Gibco (UK). Streptomycin was from Troje medical Gmbh (Germany). All the plates and dishes employed in this study were purchased from SPL (Korea). Otherwise, it was mentioned in the manuscript.

3.2. Cell Culture

T47D cells were provided from the National Cell Bank of Iran (Pasteur Institute, Tehran, Iran). The cells were cultured in RPMI-1640, 500 U/mL of penicillin, and 200 mg/L of streptomycin supplemented with 10% heat-inactivated fetal bovine serum at 37°C in 98% humidity and 5% CO2 in an incubator (Memmert, Germany). The cells were sub-cultured when their confluency reached 90%.

3.3. Growth Curve

T47D cells were seeded at densities of 10,000 cells/well in 24-well plates. The number of cells was then assessed by direct counting on days 0 to 7 after culturing. The doubling time (Td) of cells was calculated according to the Patterson formula, as follows:

Equation 1.

where N1 is the number of cells on the first day of the exponential phase, N2 is the number of cells at time T (hour) after culture (the end of the exponential phase), and T (hour) is the time from N1 to N2.

3.4. Clonogenic Assay

Appropriate numbers of T47D cells were seeded in 35-mm Petri dishes. After incubation of cells at 37°C for 11 days, the colonies were fixed, stained, and counted. The surviving fraction was calculated as the number of colonies counted divided by the number of cultured cells multiplied by 100.

3.5. MTT Assay

T47D cells were seeded at densities of 3,000 and 6,000 cells/well for 24 and 48 hours, respectively. Next, the cells were treated by various concentrations of dalbergin (0, 0.000001, 0.00001, 0.0001, 0.001, 0.01, 0.1, 1, 10, and 30 µM) and incubated for 24, 48, and 72 hours. Subsequently, 100 µL of MTT solution at a concentration of 0.5 mg/mL was added and the cells were incubated for 3 hours, followed by the addition of 100 µL of DMSO to dissolve formazan crystals. The absorbance intensities at 570 nm and 630 nm were measured using a Microplate Spectrophotometer (BioTek, Winooski, USA). The difference in absorbance between the two wavelengths was measured and the percentage of viable cells was calculated for each concentration of dalbergin as the absorbance of the sample divided by the absorbance of the control multiplied by 100.

3.6. Clonogenic Assay Following Dalbergin Treatment

Sufficient numbers of T47D cells were plated in 24-well plates at densities of 10,000 and 15,000 cells/well. Next, the cells were treated by different concentrations of dalbergin (0, 0.000001, 0.00001, 0.0001, 0.001, 0.01, 0.1, 1, 10, and 30 µM) and incubated for 48 hours. Afterward, appropriate numbers of cells were harvested, seeded in 35-mm Petri dishes, and incubated for 11 days. Finally, the colonies formed were fixed using formaldehyde solution 2% and stained with crystal violet 5%. Then, colonies containing more than 50 cells were counted.

3.7. Quantification of Gene Transcription by Real-Time PCR

The effect of dalbergin on the mRNA levels of marker genes p53, Bcl2, STAT3, and GAPDH was determined by RT-PCR. T47D cells were seeded and incubated for 48 hours. Afterward, the cells were treated with dalbergin for 48 hours. Next, total RNA was extracted by RNX-Plus solution (CinnaGen, Tehran, Iran) according to the manufacturer’s instruction. To remove DNA impurity, DNase (Fermentas Pittsburgh PA, USA) was applied at 37°C for 30 minutes, quantified by spectrophotometry, and electrophoresed on a 1% agarose gel. For cDNA synthesis, 1 µg of total RNA was used according to the manufacturer’s instructions. Moreover, we used EDTA (CinnaGen, Tehran, Iran), dNTP (CinnaGen, Tehran, Iran), random hexamer primer (Fermentas, Pittsburgh PA, USA), reverse transcriptase (Fermentas Pittsburgh PA, USA), RNase buffer (Fermentas Pittsburgh PA, USA), and DEPC water (CinnaGen, Tehran, Iran). Then, 9 µL of the reaction mixture containing 1 µL of primers and 5 µL of SYBR Green I Master Mix (QuantiFast SYBR Green PCR, Q204054) were added to 1 µL of cDNA and the Real-Time Thermocycler (RotorGene 6000, Corbett Life Science, USA) started. The thermocycler program was as follows: initial denaturation at 95°C for 5 minutes, denaturation at 95°C for 15 seconds, optimized annealing temperature from 60 to 61°C for 25 seconds, and extension at 72°C for 25 seconds. The whole process was repeated for 35 cycles. The melt curve analysis was done in each real-time PCR experiment. All the four mentioned steps were applied in different groups including controls, p53, Bcl-2, and STAT3.

3.8. Statistical Analysis

The data were analyzed by one-way analysis of variance (ANOVA). All experiments were performed in triplicate and P values of < 0.05 were considered significant. Comparing the mRNA levels of p53, STAT3, Bcl-2, and their active forms were made using the GraphPad Prism 7 (GraphPad Prism Software Inc., San Diego, CA, USA).

4. Results
4.1. Doubling Time

Figure 1 shows the growth curve of T47D cells. The number of cells was calculated for seven days. T47D cells showed the lag, log, stationary, and decline phases in 0 - 1, 1 - 5, 5 - 6, and 6 - 7 days, respectively. The doubling time is the time required for cells to double in the exponential phase. Thus, the baseline doubling time of T47D cells was calculated as 28.02 ± 4.22 hours (P < 0.05; Table 1).

Table 1. Results of T47D Doubling Time After Seven-Day Culture
T47D SamplesDoubling Time, hMean ± SD
123.1928.02 ± 4.22
229.85
331.02
The T47D growth curve showing the number of cells in seven days (P &lt; 0.05). Values are expressed as mean ± SD of three independent experiments.
Figure 1. The T47D growth curve showing the number of cells in seven days (P < 0.05). Values are expressed as mean ± SD of three independent experiments.
4.2. Plating Efficiency Assay

The plating efficiency of T47D cells was determined. The number of colonies formed increased with increasing the number of cells seeded in each plate. This step was necessary to determine the suitable number of cells for the clonogenic assay (Figure 2 and Table 2).

Table 2. The Results of the Clonogenic Ability of T47D Cells in the Presence of Different Concentrations of Dalbergina
Cell NumberColony NumberSEMPlating Efficiency, %SEM
500612.6712.20.53
75098.336.3313.110.84
10001426.3314.20.63
1500227.838.8315.190.59
20003226.3316.10.32

aValues are expressed as mean ± SD of three independent experiments.

The plating efficiency of T47D cells; A, the values are the mean ± SEM of three experiments (P &lt; 0.05); B, the photomicrograph of colonies formed by T47D cells (with cell numbers of higher than 50) observed under a microscope (×400).
Figure 2. The plating efficiency of T47D cells; A, the values are the mean ± SEM of three experiments (P < 0.05); B, the photomicrograph of colonies formed by T47D cells (with cell numbers of higher than 50) observed under a microscope (×400).
4.3. MTT Cell Viability Assay

The effect of dalbergin on the proliferation of T47D cells was examined by the MTT assay. Figure 3 presents the cytotoxicity of dalbergin to T47D cells. The induced toxicity depended on the incubation time and dalbergin concentration. The IC50 values for T47D cells were found to be 1 µM in 24 hours, 0.001 µM in 48 hours, and 0.00001 µM in 72 hours of incubation. The cytotoxicity of 0 - 30 µM dalbergin to T47D cells gradually decreased from 24 hours to 72 hours (P < 0.05; Table 3).

Table 3. The IC50 Values for This Cells After 24, 48, 72 Hoursa
Dalbergin, µMIncubation Time, hMean ± SD
12454.62 ± 3.58
0.0014851.45 ± 2.12
0.000017250.58 ± 1.02

aValues are expressed as mean ± SD of three independent experiments.

The effect of dalbergin on the viability of the T47D breast cancer cell line. The cells were treated with 0, 0.000001, 0.00001, 0.0001, 0.001, 0.01, 0.1, 1, 10, and 30 µM dalbergin for 24, 48, and 72 hours. The cell viability was evaluated by MTT assay. Dalbergin reduced cell viability.
Figure 3. The effect of dalbergin on the viability of the T47D breast cancer cell line. The cells were treated with 0, 0.000001, 0.00001, 0.0001, 0.001, 0.01, 0.1, 1, 10, and 30 µM dalbergin for 24, 48, and 72 hours. The cell viability was evaluated by MTT assay. Dalbergin reduced cell viability.
4.4. Colony Assay in the Presence of Dalbergin

The plating efficiency of T47D cells was examined following for 48 hours of treatment with various concentrations of dalbergin (0, 0.000001, 0.00001, 0.0001, 0.001, 0.01, 0.1, 1, 10, and 30 µM). Different cell numbers (500, 750, 1000, 1500, and 2000) were tested. Based on the results presented in Figure 4A - E, dalbergin could considerably decrease the colony formation ability of T47D cells. As can be seen in Figure 5, a concentration of 0.001 µM dalbergin decreased the number of colonies to half of the control’s count after 48 hours. Data represent the mean ± standard deviation (SD) of three independent experiments (P < 0.05; Table 4).

Table 4. The Mean Colony Count of T47D Cells After Treatment with Various Concentrations of Dalbergin for 48 Hoursa
Colony Count500 Cells750 Cells1000 Cells1500 Cells2000 Cells
Control100.68147.83183.17264.83339.33
DMSO97.83141.67173.67248.5318
0.000001 µM91.5132.17165.33233.67292.33
0.00001 µM89121.5153.83217.17273.33
0.0001 µM79116145.67201.83248.5
0.001 µM41.6758.3367.6781.1798.17
0.01 µM3847.6758.1777.6794.33
0.1 µM384654.6776.8388.83
1 µM31.3343.1749.6762.6779.5
10 µM23.527.173345.6757
30 µM11.513.17141516.33
SDEV33.2650.4163.9393.66120.13
SEM23.5235.6445.2166.2384.95

aThe colonies were counted after 11 days. The experiment was performed in triplicate.

The effect of various concentrations of dalbergin on different T47D cell numbers (500, 750, 1000, 1500, and 2000) after 48-hours incubation. Values are expressed as mean ± SD of three independent experiments (P &lt; 0.05).
Figure 4. The effect of various concentrations of dalbergin on different T47D cell numbers (500, 750, 1000, 1500, and 2000) after 48-hours incubation. Values are expressed as mean ± SD of three independent experiments (P < 0.05).
The plating efficiency for various cell numbers in the presence of different dalbergin concentrations (P &lt; 0.05). Values are expressed as mean ± SD of three independent experiments.
Figure 5. The plating efficiency for various cell numbers in the presence of different dalbergin concentrations (P < 0.05). Values are expressed as mean ± SD of three independent experiments.
4.5. Primers

Primer sequences were used in this study for gene transcription analysis by real-time PCR. The sequences of all primers used and amplicon lengths are listed in Table 5. GAPDH, a housekeeping gene, was used as a control. The fold change of each target gene (p53, Bcl-2, and STAT3) relative to GAPDH was calculated based on the relative quantitation using the ΔΔCT method, calculated by the 2-ΔΔCT relative transcription formula.

Table 5. Primer Sequences for Each Target Gene
Genes/PrimersSequenceAmplicon, bp
STAT3123
F5’CTGAAGCTGACCCAGGTAGC3’
R5’GCATCAATGAATCTAAAGTGCGGG3’
Bcl-2356
F5’GATACTGAGTAAATCCATGCAC3’
R5’AGTGTTGCAGAATATTCAGCCAC3’
GAPDH (RT-PCR)115
F5’CCATGAGAAGTATGACAAC3’
R5’GAGTCCTTCCACGATACC3’
p53156
F5’GCTCAGATAGCGATGGTCTGGC3’
R5’AGTGGATGGTGGTACAGTCAGAG3’
GAPDH (qRT-PCR)360
F5’CCAGCCGAGCCACATCGCTC3’
R5’ATGAGCCCCAGCCTTCTCCAT3’
4.6. Real Time-PCR

Because the p53, Bcl-2, and STAT3 genes have been reported to play a role in positive estrogen receptor breast cancer cells, it was of interest to compare the mRNA levels in the highly invasive breast cancer cell line. Therefore, gene transcriptions were compared in the absence and presence of 0.001 µM dalbergin. The results showed that p53, Bcl-2, and STAT3 mRNA levels were significantly higher in the T47D cells treated with dalbergin than in the untreated cells. All measurements were done twice in a duplicate analysis (Figure 6 and Table 6).

Table 6. The mRNA Levels of p53, STAT3, and Bcl-2 Genes in T47D Cells After 48-Hours Treatment with 0.001 µM Dalbergin
SamplesmRNA LevelSD
T47D (p53)0.0630.347
T47D + Dalbergin (p53)0.1110.337
T47D (STAT3)0.0550.397
T47D + Dalbergin (STAT3)0.0950.316
T47D (Bcl-2)0.0930.284
T47D + Dalbergin (Bcl-2)0.4270.011
Relative mRNA levels of p53, Bcl-2, and STAT3 in T47D cells in the presence or absence of 0.001 µM dalbergin. Values are expressed as mean ± SD of two independent experiments (P &lt; 0.05).
Figure 6. Relative mRNA levels of p53, Bcl-2, and STAT3 in T47D cells in the presence or absence of 0.001 µM dalbergin. Values are expressed as mean ± SD of two independent experiments (P < 0.05).
5. Discussion

Breast cancer is the most common female cancer, accounting for 23% of all cancer cases among women around the globe (16). The use of cytotoxic chemotherapy has been effective in both advanced and early-stage breast cancer (17). Polyphenols are found in plants, fruits, and vegetables. They are specific components of a healthy diet (18). Anti-inflammatory and antioxidant properties have been reported for polyphenols (19). Natural polyphenols are among the plants’ secondary metabolites (20). Dalbergin as a polyphenolic compound is the most prevalent neoflavene in the plant kingdom (21). It has been used traditionally to cure many diseases (22). Dalbergin is characterized by antioxidant and free radical scavenging properties. Its antioxidant activity has been shown by in vitro studies (23). We examined the effect of dalbergin on T47D cells viability using four complementary tests. In this experiment, we assessed T47D cell growth (24, 25). The doubling time was 28.02 ± 4.22 hours, which a suitable time in growth curves.

The MTT assay is a widely used test to measure cell proliferation, cell viability/survival, and drug toxicity. Recently, MTT has been described as one of the main techniques for testing tumor cell cytotoxicity of polyphenols. MTT assay disclosed the cytotoxic activity of dalbergin (26). Dalbergin reduced cell viability measured by MTT assay to approximately 50% after 24, 48, and 72-hours treatment of T47D cells. The IC50 values for T47D cells were found to be 1 µM at 24 hours, 0.001 µM at 48 hours, and 0.00001 µM at 72 hours of treatment.

Colony forming or clonogenic assay is an in vitro quantitative technique to examine the capability of a single cell to grow into a large colony through clonal expansion. Many polyphenols can decrease colony counts in estrogen receptor-positive human breast cancer cell lines (27). T47D cell colonies comprising more than 50 cells were detected after day 10 of growth (28). According to our results, treatment of various counts of T47D cells (500, 750, 1000, 1500, and 2000 cells) with various concentrations of dalbergin for 48 hours could decrease colony counts. According to colony formation assays, we found that dalbergin could inhibit the colony forming ability of T47D cells.

Furthermore, we evaluated the apoptotic effect of dalbergin by measuring the transcription level of apoptotic-related genes in T47D cells in the presence or absence of dalbergin. Quantitative real-time PCR demonstrated that treatment with this drug could increase the mRNA levels of Bcl-2, p53, and STAT3 genes (29). This result showed that dalbergin presents anticancer activities and can induce apoptosis in T47D cells. We suggest that p53, Bcl-2, and STAT3 are novel, valuable therapeutic targets for T47D treatment because they are implicated at many stages of tumor progression, including cell growth, survival, and invasion. This signaling pathway may have potential therapeutic values in the treatment of breast cancer cells.

In this study, we used a polyphenol to treat cancer cells because this plants’ secondary metabolite has some features such as antioxidant and anti-inflammatory properties and can modulate multiple molecular events involved in carcinogenesis (30). Another reason for its use as an anticancer is its oxygen scavenging property (31). This group of polyphenols, specifically dalbergin, is superior to other groups due to their fewer side effects and their capability to kill cancer cells. Studies have shown that anthocyanidin treatment induced apoptosis and cell cycle arrest in several types of cancer. However, this polyphenol can do this function by the suppression of the NF-κB pathway (32) whereas dalbergin can induce apoptosis via p53, Bcl-2, and STAT3. Jahanafrooz et al. used neoflavonoids as chemopreventive agents and showed they could block TNF-α-induced NF-κB activation. The IC50 values were in the range of 0.11 - 3.2 µM. However, in this investigation, we used low concentrations compared to the mentioned range. Silibinin, a polyphenol, could cause G1 cell cycle arrest in MCF-7 and MCF-10A cells but had no effect on the T47D cell cycle (33, 34). This is while in this study, dalbergin could induce apoptosis. Like dalbergin, another polyphenol could decrease the viability of T47D cells in the concentration and time-dependent manners (35). Thus, polyphenols can arrest the cell cycle in men and women-specific cancer. Further research is required to confirm if dalbergin can inhibit breast cancer in vivo. The authors can use mouse models in future studies. Although the data are still limited, the results appear promising. Moreover, using dalbergin as a potential modulator of chemotherapy and radiotherapy deserves further investigation.

5.1. Weak Points and Limitations

We did not use more molecular and cellular tests, such as comet assay, western blot, etc. because of a budget limitation. Moreover, we can use mouse models in future studies.

5.2. Strong Points

Breast cancer is a highly important issue in medicine. This study reports that dalbergin can activate apoptotic-inducing pathways in the T47D cell line. The researchers hope that the findings of this preliminary study are promising.

5.3. Conclusions

The study focused on the analysis of the anticancer effect of dalbergin. In conclusion, the results demonstrate the possibility of using dalbergin as a drug for cancer therapy. Based on our findings, it is necessary to conduct more in vitro studies and clinical trials to identify the anticancer effects and mechanism of dalbergin action inside the human body.

Acknowledgements
Footnotes
References
  • 1. Spitale A, Mazzola P, Soldini D, Mazzucchelli L, Bordoni A. Breast cancer classification according to immunohistochemical markers: Clinicopathologic features and short-term survival analysis in a population-based study from the South of Switzerland. Ann Oncol. 2009;20(4):628-35. doi: 10.1093/annonc/mdn675. [PubMed: 19074747].
  • 2. Wu AH, Yu MC, Tseng CC, Pike MC. Epidemiology of soy exposures and breast cancer risk. Br J Cancer. 2008;98(1):9-14. doi: 10.1038/sj.bjc.6604145. [PubMed: 18182974]. [PubMed Central: PMC2359677].
  • 3. Khazaee-Pool M, Montazeri A, Majlessi F, Rahimi Foroushani A, Nedjat S, Shojaeizadeh D. Breast cancer-preventive behaviors: Exploring Iranian women's experiences. BMC Womens Health. 2014;14(1):41. doi: 10.1186/1472-6874-14-41. [PubMed: 24606758]. [PubMed Central: PMC3973958].
  • 4. Leon-Gonzalez AJ, Auger C, Schini-Kerth VB. Pro-oxidant activity of polyphenols and its implication on cancer chemoprevention and chemotherapy. Biochem Pharmacol. 2015;98(3):371-80. doi: 10.1016/j.bcp.2015.07.017. [PubMed: 26206193].
  • 5. Kang NJ, Shin SH, Lee HJ, Lee KW. Polyphenols as small molecular inhibitors of signaling cascades in carcinogenesis. Pharmacol Ther. 2011;130(3):310-24. doi: 10.1016/j.pharmthera.2011.02.004. [PubMed: 21356239].
  • 6. Chen D, Dou QP. Tea polyphenols and their roles in cancer prevention and chemotherapy. Int J Mol Sci. 2008;9(7):1196-206. doi: 10.3390/ijms9071196. [PubMed: 19325799]. [PubMed Central: PMC2635719].
  • 7. Choudhary D, Kushwaha P, Gautam J, Kumar P, Verma A, Kumar A, et al. Fast and long acting neoflavonoids dalbergin isolated from Dalbergia sissoo heartwood is osteoprotective in ovariectomized model of osteoporosis: Osteoprotective effect of Dalbergin. Biomed Pharmacother. 2016;83:942-57. doi: 10.1016/j.biopha.2016.08.010. [PubMed: 27522257].
  • 8. Kong W, Sun R, Gao Y, Nan G, Yang G, Li Y. Dissociation constants and solubilities of dalbergin and nordalbergin in different solvents. J Chem Eng Data. 2015;60(9):2585-93. doi: 10.1021/acs.jced.5b00098.
  • 9. Li SR, Chen LY, Tsai JC, Tzeng JY, Tsai IL, Wang EC. New syntheses of dalbergichromene and dalbergin from vanillin via neoflavene intermediate. Tetrahedron Lett. 2007;48(12):2139-41. doi: 10.1016/j.tetlet.2007.01.117.
  • 10. Hsu S, Lewis J, Singh B, Schoenlein P, Osaki T, Athar M, et al. Green tea polyphenol targets the mitochondria in tumor cells inducing caspase 3-dependent apoptosis. Anticancer Res. 2003;23(2B):1533-9. [PubMed: 12820420].
  • 11. Kim NY, Pae HO, Oh GS, Kang TH, Kim YC, Rhew HY, et al. Butein, a plant polyphenol, induces apoptosis concomitant with increased caspase-3 activity, decreased Bcl-2 expression and increased Bax expression in HL-60 cells. Pharmacol Toxicol. 2001;88(5):261-6. [PubMed: 11393587].
  • 12. Chen J. The cell-cycle arrest and apoptotic functions of p53 in tumor initiation and progression. Cold Spring Harb Perspect Med. 2016;6(3). a026104. doi: 10.1101/cshperspect.a026104. [PubMed: 26931810]. [PubMed Central: PMC4772082].
  • 13. Pitteri SJ, Kelly-Spratt KS, Gurley KE, Kennedy J, Buson TB, Chin A, et al. Tumor microenvironment-derived proteins dominate the plasma proteome response during breast cancer induction and progression. Cancer Res. 2011;71(15):5090-100. doi: 10.1158/0008-5472.CAN-11-0568. [PubMed: 21653680]. [PubMed Central: PMC3148311].
  • 14. Avalle L, Camporeale A, Camperi A, Poli V. STAT3 in cancer: A double edged sword. Cytokine. 2017;98:42-50. doi: 10.1016/j.cyto.2017.03.018. [PubMed: 28579221].
  • 15. Ozmen V. Breast cancer in the world and Turkey. J Breast Health. 2008;4(2):6-12.
  • 16. Hassan MS, Ansari J, Spooner D, Hussain SA. Chemotherapy for breast cancer (Review). Oncol Rep. 2010;24(5):1121-31. doi: 10.1093/nutrit/nux012. [PubMed: 20878101].
  • 17. Grosso G, Bella F, Godos J, Sciacca S, Del Rio D, Ray S, et al. Possible role of diet in cancer: Systematic review and multiple meta-analyses of dietary patterns, lifestyle factors, and cancer risk. Nutr Rev. 2017;75(6):405-19. doi: 10.1093/nutrit/nux012. [PubMed: 28969358].
  • 18. Grosso G. Effects of polyphenol-rich foods on human health. Nutrients. 2018;10(8). doi: 10.3390/nu10081089. [PubMed: 30110959]. [PubMed Central: PMC6115785].
  • 19. Zhou Y, Li Y, Zhou T, Zheng J, Li S, Li HB. Dietary natural products for prevention and treatment of liver cancer. Nutrients. 2016;8(3):156. doi: 10.3390/nu8030156. [PubMed: 26978396]. [PubMed Central: PMC4808884].
  • 20. Tsao R. Chemistry and biochemistry of dietary polyphenols. Nutrients. 2010;2(12):1231-46. doi: 10.3390/nu2121231. [PubMed: 22254006]. [PubMed Central: PMC3257627].
  • 21. Bhattacharya M, Singh A, Ramrakhyani C. Dalbergia sissoo-an important medical plant. J Med Plant Res. 2014;2(2).
  • 22. Al-Snaf AE. Chemical constituents and pharmacological effects of Dalbergia sissoo - A review. IOSR J Pharm (IOSRPHR). 2017;7(2):59-71. doi: 10.9790/3013-0702015971.
  • 23. Liu BW, Wang TJ, Li LL, Zhang L, Liu YX, Feng JY, et al. Oncoprotein HBXIP induces PKM2 via transcription factor E2F1 to promote cell proliferation in ER-positive breast cancer. Acta Pharmacol Sin. 2019;40(4):530-8. doi: 10.1038/s41401-018-0015-9. [PubMed: 29925919].
  • 24. Lumachi F, Brunello A, Maruzzo M, Basso U, Basso SM. Treatment of estrogen receptor-positive breast cancer. Curr Med Chem. 2013;20(5):596-604. doi: 10.5530/pj.2018.1.7. [PubMed: 23278394].
  • 25. Nur RM, Nugroho LH. Cytotoxic activities of fractions from dioscorea bulbifera L. chloroform and methanol extracts on T47D breast cancer cells. Pharmacogn J. 2017;10(1):33-8. doi: 10.5530/pj.2018.1.7.
  • 26. Taghizadeh B, Ghavami L, Nikoofar A, Goliaei B. Equol as a potent radiosensitizer in estrogen receptor-positive and -negative human breast cancer cell lines. Breast Cancer. 2015;22(4):382-90. doi: 10.1007/s12282-013-0492-0. [PubMed: 24014377].
  • 27. He X, Arslan AD, Ho TT, Yuan C, Stampfer MR, Beck WT. Involvement of polypyrimidine tract-binding protein (PTBP1) in maintaining breast cancer cell growth and malignant properties. Oncogenesis. 2014;3. e84. doi: 10.1038/oncsis.2013.47. [PubMed: 24418892]. [PubMed Central: PMC3940912].
  • 28. Sari S, Hashemi M, Mahdian R, Parivar K, Rezayat M. The effect of pentoxifylline on bcl-2 gene expression changes in hippocampus after ischemia-reperfusion in wistar rats by a quatitative RT-PCR method. Iran J Pharm Res. 2013;12(3):495-501. [PubMed: 24250655]. [PubMed Central: PMC3813272].
  • 29. Ren B, Li D, Si L, Ding Y, Han J, Chen X, et al. Alteronol induces cell cycle arrest and apoptosis via increased reactive oxygen species production in human breast cancer T47D cells. J Pharm Pharmacol. 2018;70(4):516-24. doi: 10.1111/jphp.12879. [PubMed: 29411391].
  • 30. Mileo AM, Miccadei S. Polyphenols as modulator of oxidative stress in cancer disease: New therapeutic strategies. Oxid Med Cell Longev. 2016;2016:6475624. doi: 10.1155/2016/6475624. [PubMed: 26649142]. [PubMed Central: PMC4663347].
  • 31. Gaikwad KK, Lee YS. Novel natural phenolic compound-based oxygen scavenging system for active packaging applications. Journal of Food Measurement and Characterization. 2016;10(3):533-8. doi: 10.1007/s11694-016-9332-1.
  • 32. Zhou Y, Zheng J, Li Y, Xu DP, Li S, Chen YM, et al. Natural polyphenols for prevention and treatment of cancer. Nutrients. 2016;8(8). doi: 10.3390/nu8080515. [PubMed: 27556486]. [PubMed Central: PMC4997428].
  • 33. Luqman S, Meena A, Singh P, Kondratyuk TP, Marler LE, Pezzuto JM, et al. Neoflavonoids and tetrahydroquinolones as possible cancer chemopreventive agents. Chem Biol Drug Des. 2012;80(4):616-24. doi: 10.1111/j.1747-0285.2012.01439.x. [PubMed: 22726671]. [PubMed Central: PMC3448855].
  • 34. Jahanafrooz Z, Motameh N, Bakhshandeh B. Comparative evaluation of silibinin effects on cell cycling and apoptosis in human breast cancer MCF-7 and T47D cell lines. Asian Pac J Cancer Prev. 2016;17(5):2661-5. [PubMed: 27268647].
  • 35. Bigdeli B, Goliaei B, Masoudi-Khoram N, Jooyan N, Nikoofar A, Rouhani M, et al. Enterolactone: A novel radiosensitizer for human breast cancer cell lines through impaired DNA repair and increased apoptosis. Toxicol Appl Pharmacol. 2016;313:180-94. doi: 10.1016/j.taap.2016.10.021. [PubMed: 27984132].
  • COMMENTS

    LEAVE A COMMENT HERE: