IF: 0.644
REUTERS THOMSON

Protective Role of ADA*2 Allele of the Adenosine Deaminase Gene Against Recurrent Spontaneous Abortions in Iranian Women

AUTHORS

Naeimeh Najafi 1 , 2 , Ali-Reza Ahmadi ORCID 1 , * , Reza Hajihosseini 2 , Sepideh Khodaverdi 3 , Atefeh Mohammadi 1

AUTHORS INFORMATION

1 Department of Biomedical Sciences, Alzahra University, Tehran, Iran

2 Departmant of Biochemistry, Payame Noor University of East Tehran, Tehran, Iran

3 Department of Obstetrics and Gynecology, Endometriosis Research Center, Iran University of Medical Sciences (IUMS), Tehran, Iran

How to Cite: Najafi N , Ahmadi A, Hajihosseini R, Khodaverdi S , Mohammadi A . Protective Role of ADA*2 Allele of the Adenosine Deaminase Gene Against Recurrent Spontaneous Abortions in Iranian Women, Iran Red Crescent Med J. Online ahead of Print ; 21(7):e86602. doi: 10.5812/ircmj.86602.

ARTICLE INFORMATION

Iranian Red Crescent Medical Journal: 21 (7); e86602
Published Online: July 23, 2019
Article Type: Research Article
Received: November 20, 2018
Revised: June 16, 2019
Accepted: June 18, 2019
Crossmark

Crossmark

CHEKING

READ FULL TEXT
Abstract

Background: Adenosine deaminase (ADA) is involved in recurrent spontaneous abortion (RSA) while normal pregnancy is defined by suppressed cell-mediated immunity.

Objectives: This study aimed to determine the connection between single nucleotide polymorphism (SNP) G22A and protection against RSA.

Methods: In this analytical case-control study, the allele frequency of ADA G22A gene polymorphism was determined in 113 participants including 50 women with RSA and 63 healthy pregnant women using RFLP-PCR to determine if there is a statistically significant difference in the frequency of ADA genotypes between the patient group and the control group.

Results: The frequency of ADA2/ADA2 (AA) genotype was significantly different between RSA patients and controls (P = 0.004) while no significant differences were identified in the genotype frequency of ADA1/ADA1 (GG) (OR = 0.678; P = 0.228) and ADA1/ADA2 (GA) (OR = 0.976; P = 0.943). SNP G22A in the ADA gene was associated with the protection against RSA. The frequency of ADA alleles in RSA patients was compared between the age groups, and the results indicated that the ADA2 (A) allele was associated with protection against RSA in patients aged 35 years or younger (P < 0.0001).

Conclusions: The findings showed that women carrying the ADA*2 allele are protected against RSA.

Keywords

Adenosine Deaminase Gene Polymerase Chain Reaction Polymorphism Pregnancy Recurrent Single Nucleotide Spontaneous Abortion

Copyright © 2019, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited

1. Background

Unexplained recurrent spontaneous abortion (RSA) is referred to as the termination of three or more pregnancies prior to the 20th week of gestation (1-4). There are several reasons for RSA including immunological, endocrine, and genetic factors (3-5%), anatomical factors, antiphospholipid syndrome (15%) (5), and infections (6). Nevertheless, about 40-50% of the cases have unknown etiologies. It is thought that certain gene polymorphisms may be implicated in the pathogenesis of unexplained RSA (3, 4, 7, 8).

Several genetic polymorphisms have been associated with RSA (9). Genetics polymorphisms in interleukin genes may lead to unexplained RSA (7, 8). It is thought that certain gene polymorphisms may be implicated in the pathogenesis of unexplained RSA (10-13).

A key purine enzyme named adenosine deaminase (ADA) is present in blood serum and most tissues, especially lymphoid tissues. ADA is essential for the maturation and function of lymphocytes, especially those of T lineage, and is required for the maturation of human blood monocytes to macrophages (14-17). ADA is one of the most important enzymes in the human reproductive system affects the metabolism of adenosine and plays a protective role in early post implantation embryonic development (18, 19). The ADA gene in the human genome is located on chromosome 20 (20q13.11) (20). The enzyme adenosine deaminase is involved in catalyzing the deamination of adenosine and deoxyadenosine into inosine and deoxyinosine, respectively. This catalytic pathway is essential for lymphocyte proliferation and differentiation (21).

A study by Martinez-Navio et al. suggested that ADA had a potential role in the generation of effector, memory, and regulatory CD4+ T cells (22). The common G22A polymorphism in the ADA gene leads to the nucleotide substitution of asparagine for aspartic acid at codon 8 (Asp8Asn) and production of ADA*2 isoenzyme with lower enzymatic activity and subsequently causes increased tissue concentrations of adenosine (11, 23-26). The increased ratio of adenosine may play a fundamental role in pregnancy maintenance (23). Much research in the European population and among Brazilian women (27) has been conducted to assess the association of G22A polymorphism with RSA.

2. Objectives

We hypothesized that the ADA*2 allele maintains the pregnancy against RSA. To examine this hypothesis, we compared the distribution of ADA genotypes in women with RSA and a control group in an Iranian population.

3. Methods

This study was approved by the Payame-Noor University Ethic Committee (Reference No. 167/D/11837) and the Department of Biomedical Sciences, Alzahra University, Tehran, Iran. All the participants signed informed consent after explaining the objectives of the study.

3.1. Study Population and Sampling

This study was carried out in 2017 - 2018 at the Department of Biomedical Sciences, Women Research Center, Alzahra University, Tehran, Iran. The sample size was calculated with an 85% power at a significance level of 95% and considering a Standard Deviation (SD) (https://clincalc.com/stats/samplesize.aspx).

In this study, 53 whole blood samples were collected from women with RSA (age range: 23 - 54 years, Body Mass Index (BMI): 29.44 ± 5.17, and mean age ± standard deviation: 37.5 ± 7.51) referring to Shahid Akbar Abadi Hospital, affiliated to the Iran University of Medical Sciences, in Tehran and 63 women as the control group (age range: 26 - 50 years, BMI: 29.1 ± 4.81, and mean age ± standard deviation: 38.52 ± 7.50).

All RSA cases were diagnosed based on at least two recurrent spontaneous abortions in less than 20 weeks of gestational age. The control group women were enrolled based on the following criteria: regular menstrual cycles, no history of pregnancy loss, and a history of at least two natural pregnancies. Controls and patients with RSA had a single partner during their reproductive age. Patients with RSA were confirmed to be negative for the chromosomal abnormalities, infectious diseases, history of diabetes, and polycystic ovarian syndrome (PCOS). Controls and patients with RSA were originally from different parts of Iran. From all participants, 5-ml venous blood samples were collected in ethylene-diamine-tetra-acetic acid (EDTA) tubes for DNA extraction.

3.2. Genetic Analysis

Genomic DNA extraction from the blood was carried out by the salting-out method as described by Miller et al. (28). Then, genomic DNA of blood samples was determined with a spectrophotometer at 260 nm. The samples were diluted to standard concentrations and stored at -20°C until gene analysis.

3.2.1. Verification of ADA*1 and ADA*2 of the ADA Gene

The verification of the ADA*1 and ADA*2 alleles was done using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. A gene amplification reaction (25 µl of total volume) was performed for each sample of genomic DNA under the following conditions: 2 µl of genomic DNA, 1.25 µl of sense primer (GCCCGGCCCGTTAAGAAGAGC), 1.25 µl of anti-sense primer (GGTCAAGTCAGGGGCAGAAGCAGA), 2 µl of DMSO, 1.5 µl of MgCl2 (25 mM), 5 µl of 10x PCR Buffer, 4.0 µl of dNTPs (1.25 mM), 0.5 µl of Taq DNA polymerase, and 7.5 µl of deionized water (CinnaGen Co. Tehran, Iran). The amplification conditions were as follows: initial denaturation at 95°C for 5 min, 35 cycles of denaturation at 95°C for 30 s, annealing at 66°C for 45 s, extension at 72°C for 45 s, and a final extension at 72°C for 8 min. PCR was carried out in a PTC-1148 programmable thermal controller (BioRAD, USA). The amplified 397-bp fragment was analyzed by 1.5% agarose gel electrophoresis and ethidium bromide staining. The PCR product (15 µl) was incubated at 65°C with 0.3 mL of Taq I (3000 U, Fermentas), 2.5 µl of enzyme buffer (10x, Fermentas), and 2.5 µl of deionized water overnight. The DNA fragments were subjected to electrophoresis on a 3.5% agarose gel stained with ethidium bromide. The ADA*2 allele (22A) was identified by the absence of the Taq I restriction site and the presence of the 397 bp fragment. The PCR product of the ADA*1 allele (G22) was split into two fragments (245 bp and 152 bp) (Figure 1).

3.3. Statistical Analysis

Statistical analysis was performed by StatPages.info online program. Data were analyzed using the chi-square test to detect differences in the distribution of ADA genotypes and alleles concering RSA. Moreover, the odds ratios (OR) and 95% confidence intervals (CIs) were calculated to estimate the effect of ADA genotypes and alleles on the RSA risk. Significant differences in the ADA genotypes and alleles were indicated at a P value of < 0.005.

4. Results

The demographic characteristics of the RSA patients and controls are presented in Table 1. The groups were matched for age and BMI (P > 0.05) while there was a significant difference in the number of pregnancies and the number of children (P < 0.05). Concerning the ADA2/ADA2 (AA) genotype frequency, there was a statistically significant difference between the RSA patients and controls (P = 0.004) while no significant differences were identified in the genotype frequencies of ADA1/ADA1 (GG) (OR = 0.678; P = 0.228) and ADA1/ADA2 (GA) (OR = 0.976; P = 0.943) (Table 2; Figure 2). Concerning the ADA1 (G) (OR = 1.842; P = 0.128) and ADA2 (A) (OR = 0.543; P = 0.128) allele frequency, there was no statistically significant difference between the RSA patients and controls (Table 2; Figure 3). The comparison of ADA allele frequency among RSA patients concerning the age groups of younger and older than 35 years showed a highly significant difference between the groups (P > 0.0001). The ADA1 (G) allele was associated with a low risk of RSA in patients aged 35 years or younger while the ADA2 (A) allele was not associated with a low risk of RSA in this age group (Table 3; Figure 4).

Table 1. Demographic Characteristics of RSA Patients and Controlsa
CharacteristicsRSA PatientsControlsP Value
Age (years)37.5 ± 7.5138.52 ± 7.500.56
BMI (Kg/m2)29.44 ± 5.1729.1 ± 4.810.68
Live birthsNone1.73 ± 0.610.000
Previous pregnancy losses3.10 ± 1.60None0.000

Abbreviations: RSA, recurrent spontaneous abortion; BMI, body mass index.

aValues are expressed as means ± SD.

Table 2. Frequencies of ADA Gene Alleles and Genotypes Among RSA Patients and Controls
ADA Genotypes and AllelesControl Frequency, No. (%)Patient Frequency, No. (%)OR (95% CI)P Value
ADA genotypes
ADA1/ADA1 (GG)44 (69.84)41 (77.35)0.678 (0.343 - 1.339)0.228
ADA1/ADA2 (GA)14 (22.22)12 (22.64)0.976 (0.477 - 1.998)0.943
ADA2/ADA2 (AA)5 (7.93)-lnf (1.545 - lnf)0.004
ADA alleles
ADA1 (G) allele102 (80.95)94 (88.67)1.842 (0.781 - 4.397)0.128
ADA2 (A) allele24 (19.04)12 (11.32)0.543 (0.228 - 1.281)0.128

Abbreviations: CI, confidence interval; OR, odds ratio.

Table 3. Allele Frequency of ADA Gene Polymorphism Based on Age Among RSA Patients
AllelesAge GroupP Value
≤ 35 Years, No. (%)> 35 Years, No. (%)
ADA1 (G)64 (60.37)30 (28.30)0.000
ADA2 (A)8 (7.54)4 (3.77)0.248
PCR-RFLP analysis of ADA gene polymorphism using TaqI restriction enzyme by agarose gel electrophoresis. Lane L: Gene ruler 100-bp DNA ladder (100 bp -1500 bp). Lanes 1, 3, 5, 7, 9, 10, 12, and 14: ADA1/ADA1 (GG) represented by two bands (152 bp and 245 bp). Lanes 2, 8, 11, and 13: ADA1/ADA2 (GA) represented by three bands (152 bp, 245 bp, and 397 bp). Lanes 4 and 6: ADA2/ADA2 (AA) represented by one band (397 bp).
Figure 1. PCR-RFLP analysis of ADA gene polymorphism using TaqI restriction enzyme by agarose gel electrophoresis. Lane L: Gene ruler 100-bp DNA ladder (100 bp -1500 bp). Lanes 1, 3, 5, 7, 9, 10, 12, and 14: ADA1/ADA1 (GG) represented by two bands (152 bp and 245 bp). Lanes 2, 8, 11, and 13: ADA1/ADA2 (GA) represented by three bands (152 bp, 245 bp, and 397 bp). Lanes 4 and 6: ADA2/ADA2 (AA) represented by one band (397 bp).
Genotype frequency of ADA gene in RSA patients and controls
Figure 2. Genotype frequency of ADA gene in RSA patients and controls
Allele frequency of ADA gene in RSA patients and controls
Figure 3. Allele frequency of ADA gene in RSA patients and controls
Allele frequency of ADA gene polymorphism in the age groups of younger and older than 35 years among RSA patients
Figure 4. Allele frequency of ADA gene polymorphism in the age groups of younger and older than 35 years among RSA patients

5. Discussion

The present study was carried out to determine if there is a relationship between the SNP G22A of the ADA gene and its protective role in Iranian women with a history of RSA.

The result of this study showed no statistically significant differences in allele frequency between the control group and the RSA patients group. In addition, no significant difference was found in the genotype frequencies of ADA1/ADA1 and ADA1/ADA2. However, significant differences were identified in the genotype frequencies of ADA2/ADA2. The results of our study showed a relationship between ADA1 allele and the lower RSA risk in 35-year-old or younger women patients. Our results also suggest a cooperative effect of ADA2/ADA2 (AA) genetic polymorphism on protection against RSA in Iranian women.

Hitoglou et al. (2004) reported that total ADA and isoenzyme ADA1 and ADA2 in serum and peripheral blood lymphocytes were significantly higher in women with RSA than in non-pregnant women. Their results showed the cell-mediated immunity role of ADA in RSA (29). In a similar study by Bonyadi et al., the protective roles of the G22A polymorphism (ADA*2 allele) and AG genotype were confirmed against RSA (30). Yoneyama et al. (2003) reported that ADA is an early indicator of trophoblast cell differentiation, and it is enriched in trophoblast cells of the placenta (17).

The protective role of ADA*2 allele against RSA was also reported by Nicotra et al. Early observations in their study showed the defensive effect of ADA-2 allele against the development of autoantibodies in RSA. The results obtained by Nicotra et al. showed that women with a history of several births had more ADA*2 allele than women who had a history of one birth or no live birth (31).

The comparison of the frequency of ADA alleles in RSA patients at various ages indicated that the ADA2 (A) allele was associated with a reduced risk of RSA among patients aged 35 years or younger. This study showed the protective role of ADA2 (A) allele in spontaneous abortion among an Egyptian population (32). Lee et al. reported the protective effect of ADA 2 (A) allele against RSA (33).

The results by Camargo et al. indicated that G22A polymorphism was not associated with ankylosing spondylitis (34). Safranow et al. studied the possibility of ADA*2 allele protection against coronary artery disease. The results showed that the ADA*2 allele frequency was lower in the patient group than in the control group. It has been suggested that the ADA*2 allele reduces the genetic susceptibility to coronary artery disease, and it has a major role in preventing the progression of heart failure (10, 35, 36).

Nicotra et al. conducted a study on the joint effect of genetic modulations of ACP1 and ADA on spontaneous abortion and found a common effect for ACP and ADA polymorphisms on protection against or susceptibility to spontaneous abortion. The results showed that women with low activity of ADA and high activity of ACP1 had the least sensitivity to RSA while women with high ADA activity and low ACP1 showed the highest sensitivity to RSA (37). The results of Salehabadi et al. showed that PCOS was not associated with G22A polymorphism. It was also found that total ADA, ADA1, and ADA2 activity were significantly lower in the PCOS group than in the control group. It was shown in this study that the low level of ADA activity might be effective in PCOS pathogenicity by maintaining adenosine at higher concentrations that could affect the follicular growth (38).

In a similar study by Nunes et al. on the ADA2 allele of the ADA gene and RSA in Brazilian women, they found no statistically significant differences in ADA alleles and genotypes between women with RSA and controls while the maternal ages were considered significant. Statistical differences were determined between ADA alleles and genotypes while they were not associated with RSA. Nunes et al. suggested that the ADA2 allele inhibited RSA in women over 35 years of age (1), possibly due to ADA function in blood flow regulation, platelet aggregation, and neurotransmission (39). The ADA presence in human uterus and the placenta has a major role in the reduction rate of early pregnancy failure; thus, the ADA*2 allele has a protective role in genetic susceptibility to RSA. On the other hand, increasing the ADA*2 allele levels participate in vascular integrity by increasing uterine and placental blood flow (37).

It is suggested that ADA polymorphism be investigated in different geographic areas with larger sample sizes in order to determine the association of ADA polymorphism in larger populations. We also suggest this test be conducted as a regular test for patients with unknown etiologic RSA.

Acknowledgements

Footnotes

References

  • 1. Nunes DP, Spegiorin LC, Mattos CC, Oliani AH, Vaz-Oliani DC, Mattos LC. The ADA*2 allele of the adenosine deaminase gene (20q13.11) and recurrent spontaneous abortions: An age-dependent association. Clinics (Sao Paulo). 2011;66(11):1929-33. doi: 10.1590/s1807-59322011001100013. [PubMed: 22086524]. [PubMed Central: PMC3203966].
  • 2. Ford HB, Schust DJ. Recurrent pregnancy loss: Etiology, diagnosis, and therapy. Rev Obstet Gynecol. 2009;2(2):76-83. [PubMed: 19609401]. [PubMed Central: PMC2709325].
  • 3. Rai R, Regan L. Recurrent miscarriage. Lancet. 2006;368(9535):601-11. doi: 10.1016/S0140-6736(06)69204-0. [PubMed: 16905025].
  • 4. Schorge JO, Schaffer JI, Halvorson LM, Hoffman BL, Bradshaw KD, Cunningham FG. First-trimester abortion. Williams gynecology. McGraw-Hill Medical; 2008.
  • 5. Rai RS, Regan L, Clifford K, Pickering W, Dave M, Mackie I, et al. Antiphospholipid antibodies and beta 2-glycoprotein-I in 500 women with recurrent miscarriage: Results of a comprehensive screening approach. Hum Reprod. 1995;10(8):2001-5. doi: 10.1093/oxfordjournals.humrep.a136224. [PubMed: 8567830].
  • 6. Diejomaoh MF. Recurrent spontaneous miscarriage is still a challenging diagnostic and therapeutic quagmire. Med Princ Pract. 2015;24 Suppl 1:38-55. doi: 10.1159/000365973. [PubMed: 25428171]. [PubMed Central: PMC6489083].
  • 7. Messaoudi S, Al-Khateeb GM, Dendana M, Sater MS, Jazia KB, Nouira M, et al. Genetic variations in the interleukin-21 gene and the risk of recurrent idiopathic spontaneous miscarriage. Eur Cytokine Netw. 2011;22(2):123-6. doi: 10.1684/ecn.2011.0287. [PubMed: 21768062].
  • 8. Zhang M, Xu J, Bao X, Niu W, Wang L, Du L, et al. Association between genetic polymorphisms in interleukin genes and recurrent pregnancy loss - a systematic review and meta-analysis. PLoS One. 2017;12(1). e0169891. doi: 10.1371/journal.pone.0169891. [PubMed: 28103273]. [PubMed Central: PMC5245830].
  • 9. Alijotas-Reig J, Garrido-Gimenez C. Current concepts and new trends in the diagnosis and management of recurrent miscarriage. Obstet Gynecol Surv. 2013;68(6):445-66. doi: 10.1097/OGX.0b013e31828aca19. [PubMed: 23942472].
  • 10. Safranow K, Rzeuski R, Binczak-Kuleta A, Czyzycka E, Skowronek J, Jakubowska K, et al. ADA*2 allele of the adenosine deaminase gene may protect against coronary artery disease. Cardiology. 2007;108(4):275-81. doi: 10.1159/000099096. [PubMed: 17287605].
  • 11. Daher S, Mattar R, Gueuvoghlanian-Silva BY, Torloni MR. Genetic polymorphisms and recurrent spontaneous abortions: An overview of current knowledge. Am J Reprod Immunol. 2012;67(4):341-7. doi: 10.1111/j.1600-0897.2012.01123.x. [PubMed: 22390536].
  • 12. Sierra S, Stephenson M. Genetics of recurrent pregnancy loss. Semin Reprod Med. 2006;24(1):17-24. doi: 10.1055/s-2006-931797. [PubMed: 16418974].
  • 13. Li TC, Makris M, Tomsu M, Tuckerman E, Laird S. Recurrent miscarriage: Aetiology, management and prognosis. Hum Reprod Update. 2002;8(5):463-81. doi: 10.1093/humupd/8.5.463. [PubMed: 12398226].
  • 14. Conway EJ, Cooke R. The deaminases of adenosine and adenylic acid in blood and tissues. Biochem J. 1939;33(4):479-92. doi: 10.1042/bj0330479. [PubMed: 16746934]. [PubMed Central: PMC1264401].
  • 15. Adams A, Harkness RA. Adenosine deaminase activity in thymus and other human tissues. Clin Exp Immunol. 1976;26(3):647-9. [PubMed: 1009688]. [PubMed Central: PMC1540957].
  • 16. Fischer D, Van der Weyden MB, Snyderman R, Kelley WN. A role for adenosine deaminase in human monocyte maturation. J Clin Invest. 1976;58(2):399-407. doi: 10.1172/JCI108484. [PubMed: 956374]. [PubMed Central: PMC333195].
  • 17. Yoneyama Y, Sawa R, Suzuki S, Otsubo Y, Miura A, Kuwabara Y, et al. Serum adenosine deaminase activity in women with pre-eclampsia. Gynecol Obstet Invest. 2002;54(3):164-7. doi: 10.1159/000067885. [PubMed: 12571439].
  • 18. Rostampour F, Biglari M, Vaisi-Raygani A, Salimi S, Tavilani H. Adenosine deaminase activity in fertile and infertile men. Andrologia. 2012;44 Suppl 1:586-9. doi: 10.1111/j.1439-0272.2011.01231.x. [PubMed: 21919946].
  • 19. Lindley ER, Pisoni RL. Demonstration of adenosine deaminase activity in human fibroblast lysosomes. Biochem J. 1993;290 ( Pt 2):457-62. doi: 10.1042/bj2900457. [PubMed: 8452534]. [PubMed Central: PMC1132295].
  • 20. Battistuzzi G, Scozzari R, Santolamazza P, Terrenato L, Modiano G. Comparative activity of red cell adenosine deaminase allelic forms. Nature. 1974;251(5477):711-3. doi: 10.1038/251711a0. [PubMed: 4427666].
  • 21. Akalal DB, Schein CH, Nagle GT. Mollusk-derived growth factor and the new subfamily of adenosine deaminase-related growth factors. Curr Pharm Des. 2004;10(31):3893-900. [PubMed: 15579078].
  • 22. Martinez-Navio JM, Casanova V, Pacheco R, Naval-Macabuhay I, Climent N, Garcia F, et al. Adenosine deaminase potentiates the generation of effector, memory, and regulatory CD4+ T cells. J Leukoc Biol. 2011;89(1):127-36. doi: 10.1189/jlb.1009696. [PubMed: 20959412].
  • 23. Gakis C. Adenosine deaminase (ADA) isoenzymes ADA1 and ADA2: Diagnostic and biological role. Eur Respir J. 1996;9(4):632-3. [PubMed: 8726922].
  • 24. Napolioni V. ADA (22G>A) polymorphism: A possible genetic marker for predictive medicine of human reproduction? Metabolism. 2010;59(10):e9-e10. doi: 10.1016/j.metabol.2010.04.006. [PubMed: 20494375].
  • 25. Stephenson M, Kutteh W. Evaluation and management of recurrent early pregnancy loss. Clin Obstet Gynecol. 2007;50(1):132-45. doi: 10.1097/GRF.0b013e31802f1c28. [PubMed: 17304030].
  • 26. Baek KH, Lee EJ, Kim YS. Recurrent pregnancy loss: The key potential mechanisms. Trends Mol Med. 2007;13(7):310-7. doi: 10.1016/j.molmed.2007.05.005. [PubMed: 17574920].
  • 27. Stirrat GM. Recurrent miscarriage. Lancet. 1990;336(8716):673-5. doi: 10.1016/0140-6736(90)92159-f. [PubMed: 1975862].
  • 28. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16(3):1215. doi: 10.1093/nar/16.3.1215. [PubMed: 3344216]. [PubMed Central: PMC334765].
  • 29. Hitoglou S, Zournatzi V, Gougoustamou D, Hatzistilianou M, Tzafettas J. Adenosine deaminase activity and its isoenzyme pattern in women with recurrent spontaneous abortions. Gynecol Obstet Invest. 2004;58(3):126-9. doi: 10.1159/000078951. [PubMed: 15192284].
  • 30. Bonyadi M, Mohammadi A, Khalajkondori M, Taghavi S. [The ADA*2 allele of the adenosine deaminase gene and recurrent spontaneous abortions in Northwest of Iran]. J Ardabil Univ Med Sci. 2015;15(2):137-43. Persian.
  • 31. Nicotra M, Bottini N, Grasso M, Gimelfarb A, Lucarini N, Cosmi E, et al. Adenosine deaminase and human reproduction: A comparative study of fertile women and women with recurrent spontaneous abortion. Am J Reprod Immunol. 1998;39(4):266-70. [PubMed: 9553651].
  • 32. Farhan HM, Abu-Gabal K, Katta M, Ibrahim R. Evaluation of the adenosine deaminase (ADA) G22A gene polymorphism with recurrent spontaneous abortion among Egyptian patients. Cent Eur J Immunol. 2017;42(3):281-6. doi: 10.5114/ceji.2017.70972. [PubMed: 29204093]. [PubMed Central: PMC5708210].
  • 33. Lee SJ, Hwang HS, Kim BN, Kim MA, Lee JW, Park YW, et al. Changes in serum adenosine deaminase activity during normal pregnancy. J Korean Med Sci. 2007;22(4):718-21. doi: 10.3346/jkms.2007.22.4.718. [PubMed: 17728516]. [PubMed Central: PMC2693826].
  • 34. Camargo U, Toledo RA, Cintra JR, Nunes DP, Acayaba de Toledo R, Brandao de Mattos CC, et al. Lack of association of the G22A polymorphism of the ADA gene in patients with ankylosing spondylitis. Genet Mol Res. 2012;11(2):1178-84. doi: 10.4238/2012.May.7.3. [PubMed: 22614344].
  • 35. He HR, Li YJ, He GH, Wang YJ, Zhai YJ, Xie J, et al. The adenosine deaminase gene polymorphism is associated with chronic heart failure risk in Chinese. Int J Mol Sci. 2014;15(9):15259-71. doi: 10.3390/ijms150915259. [PubMed: 25170811]. [PubMed Central: PMC4200810].
  • 36. Sommerschild HT, Kirkeboen KA. Adenosine and cardioprotection during ischaemia and reperfusion--an overview. Acta Anaesthesiol Scand. 2000;44(9):1038-55. [PubMed: 11028722].
  • 37. Nicotra M, Bottini N, La Torre M, Amante A, Bottini E, Gloria-Bottini F. Repeated spontaneous abortion. Cooperative effects of ADA and ACP1 genetic polymorphisms. Am J Reprod Immunol. 2007;58(1):1-10. doi: 10.1111/j.1600-0897.2007.00483.x. [PubMed: 17565542].
  • 38. Salehabadi M, Farimani M, Tavilani H, Ghorbani M, Poormonsefi F, Poorolajal J, et al. Association of G22A and A4223C ADA1 gene polymorphisms and ADA activity with PCOS. Syst Biol Reprod Med. 2016;62(3):213-22. doi: 10.3109/19396368.2016.1143055. [PubMed: 26980102].
  • 39. Wen X, Perrett D, Jones N, Tozer AJ, Docherty SM, Iles RK. High follicular fluid adenosine levels may be pivotal in the metabolism and recycling of adenosine nucleotides in the human follicle. Metabolism. 2010;59(8):1145-55. doi: 10.1016/j.metabol.2009.09.037. [PubMed: 20045541].
  • COMMENTS

    LEAVE A COMMENT HERE: