IF: 0.644
REUTERS THOMSON

IL-8 and IL-23 Levels in Peripheral Blood Mononuclear Cells of Patients with Cutaneous Leishmaniasis Caused by Leishmania major: A Case-Control Study

AUTHORS

Narges Khazaei 1 , Elham Moghaddas 1 , Seyed Abdolrahim Rezaee 2 , Seyed Aliakbar Shamsian 1 , 3 , *

1 Departments of Mycology and Parasitology, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

2 Department of Immunology, Faculty of Medicine, Mashhad University of Medical Sciences, Iran

3 Iranian Academic Center for Education, Culture, and Research (ACECR), Mashhad, Iran

How to Cite: Khazaei N , Moghaddas E, Rezaee S A, Shamsian S A. IL-8 and IL-23 Levels in Peripheral Blood Mononuclear Cells of Patients with Cutaneous Leishmaniasis Caused by Leishmania major: A Case-Control Study, Iran Red Crescent Med J. 2019 ; 21(6):e85441. doi: 10.5812/ircmj.85441.

ARTICLE INFORMATION

Iranian Red Crescent Medical Journal: 21 (6); e85441
Published Online: June 23, 2019
Article Type: Research Article
Received: October 16, 2018
Revised: April 25, 2019
Accepted: April 30, 2019
Crossmark

Crossmark

CHEKING

READ FULL TEXT
Abstract

Background: Several cytokines contribute to cutaneous leishmaniasis outcomes. IL-23 is a key cytokine in inflammation and a central cytokine in controlling Th17. IL-8, also known as a neutrophil chemotactic factor in the lesion site of cutaneous leishmaniasis, indicates disease promotion.

Objectives: This study aimed to evaluate the relationship of Leishmania major with IL-8 and IL-23 expression.

Methods: This case-control study was performed on 25 healthy individuals and 25 cutaneous leishmaniasis patients who lived in Southwestern Iran, in 2017. Peripheral blood mononuclear cells (PBMCs) were first isolated. Total RNA was extracted and reverse-transcribed into cDNA. The expression levels of IL-8 and IL-23 were measured by the real-time PCR. The data were statistically analyzed using SPSS version 16.

Results: Our findings indicated that the expression of IL-8 was significantly higher in the leishmaniasis group than in the control group with the median (IQR) of 0.39 (0.92) and 0.03 (0.11), respectively (P = 0.02). The expression of IL-23 was higher in the leishmaniasis group than in the control group with the median (IQR) of 0.13 (0.43) and 0.11 (0.61), respectively (P = 0.48). The increased IL-8 expression accompanied the location sites in face and hand and the increased number of skin lesions.

Conclusions: The expression of IL-8 in patients with cutaneous leishmaniasis is an index of increased activity of local neutrophils that can contribute to leishmaniasis survival or inflammation increase. However, IL-23 appears to be less important in the inflammatory reaction than IL-8.

Keywords

Complementary Cutaneous Cytokines DNA Human Interleukin-8 Interleukin-23 Leishmaniasis Leishmania major Real-Time Polymerase Chain Reaction

Copyright © 2019, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited

1. Background

Cytokines play determining roles in susceptibility or resistance to leishmaniasis.

Interleukin (IL)-8 is a neutrophil-chemoattractant cytokine. Neutrophils play key roles against Leishmania protozoa in the lesion site. They are the first cells that reach the bite site of female Phlebotomus spp. to protect against the proliferation of Leishman bodies (1). Indeed, neutrophils have protective roles against all Leishmania spp. and help survive the disease. Although the exact mechanism of the increased survival of Leishmania major (L. major) within neutrophils is unclear, it seems that the reduction of dendritic cells and suppression of Th1 cells and CD8+ T cells function are important (2).

IL-23 as a pro-inflammatory cytokine is composed of two subunits, p19 (IL-23 alpha) and p40 (IL-12β) that is a subunit of IL-12 whereas IL-12 induces the development of Th1 cells. Naive CD4+ T cells differentiate into Th17 in the presence of IL-23. The activity of Th17 followed by the production of IL-17 stimulates the expression of IL-1, IL-6, TNF-α, and NOS-2 (3). IL-23 is increased in inflammatory diseases such as psoriasis, rheumatoid arthritis, spondyloarthritis, and Crohn’s disease (3, 4). Anti-IL-23 monoclonal antibodies have been developed as a new therapeutic approach for psoriasis (5). Based on our knowledge, a few studies have focused on the interaction between IL23 and L. major in human samples.

The World Health Organization (WHO) estimates 0.7 to 1.2 million new cases of cutaneous leishmaniasis (CL) annually (6). Over a three-year period, 56546 people were identified with CL in Iran. Razavi Khorasan ranks third in the incidence rate of CL among 31 provinces of Iran (7).

There is no efficient vaccine for CL because of inadequate knowledge of immunity pathways against CL. Thus, studying immunological routs or responses during leishmaniasis helps find suitable immunotherapy or effective vaccine. It has been proven that IL23 and IL8 can influence leishmaniasis progression via the regulation of neutrophil recruitment in BALB/c mice (8).

2. Objectives

The roles of IL23 and IL8 are not completely clear in human leishmaniasis. Thus, in this study, we evaluated the role of IL-8 and IL-23 in the process of healing or developing infections caused by L. major.

3. Methods

3.1. Patients

This case-control study was performed on 30 patients with cutaneous lesions before any treatment who were selected from the Valfajr government health center (as a central referral health center) in Shiraz, Iran, as an endemic region of L. major. The number and location of lesions were recorded individually. Shiraz is the third most populous city of Iran located in the southwest of the country (https://en.wikipedia.org/wiki/Shiraz).

For each patient, the edge of each skin lesion was smeared using a sterile scalpel on a microscope slide, followed by air-drying, fixation with absolute ethanol, and staining with Giemsa. Some scraping wound was retained in labeled containers in 70% ethanol separately for molecular analysis. After the direct observation of slides, 10 mL of blood was taken from confirmed patients in EDTA tubes. The criteria for inclusion were having ≤ 4 cutaneous lesions and receiving no specific leishmaniasis treatment. Patients with treatment, pregnancy, or lactation were excluded from the study.

We also selected 25 age and sex-matched healthy people as the control group. The sample size was determined to include 25 individuals in each group based on the formula for comparison of two independent means with an alpha of 0.05 and a beta of 0.2 according to the mean values reported in similar studies of interleukin assessment (9, 10).

A convenience sampling method was used to select the cases from among all patients that referred to the Valfajr center after primary assessment and obtaining their consent. The control group was selected from among individuals who referred for other chief complaints matched for the age and sex of the cases. All the patients and healthy individuals were negative for intestinal parasitic diseases, diabetes, HIV, HBV, and T-lymphotropic virus type 1 (HTLV-I), or any autoimmune diseases. The study adhered to the tenets of the Declaration of Helsinki as approved by the Ethics Committee of Mashhad University of Medical Sciences (IR.MUMS.REC.1394.178). Written informed consent was obtained from all patients and healthy individuals.

3.2. PCR

After preparing direct Giemsa-stained smears from each patient, positive microscopic samples were scrapped for DNA extraction using the GeNet Bio Kit. The PCR was performed with initial denaturation for 5 min at 95°C, followed by 38 cycles of 94°C for 30 s, 60°C for 45 s, and 72°C for 60 s, ended by a final extension at 72°C for 7 min. In each round of PCR, we used L. major standard strain (MRHO/IR/75/ER) and L. tropica standard strain (MHOM/01/IR/YAZA) as positive controls and distilled water as a negative control. Statistical analysis of data was performed using the Chi-square test in IBM SPSS Statistics for Windows, version 20.0 (IBM Corp., Armonk, N.Y., USA). The primers of kDNA of Leishmania parasite included F: 5’TCGCAGAACGCCCCTACC 3’ and R: 5’AGGGGTTGGTGTAAAATAGG 3’, made by the Tuba Negin Company. DNA fragments amplified with these primers were seen at 615 bp for L. major and 744 bp for L. tropica.

All microscopes, PCR, and real-time PCR devices were calibrated every six months by the Kawsar Biotech Company, and they received certificates.

3.3. Cell Culture

Peripheral blood mononuclear cells (PBMCs) were isolated by gradient Ficoll (Sigma-Aldrich, UK). A hemocytometer was used for cell counting, and 250 μL of lymphocytes in RPMI 1640 (PAA, Austria) was transferred into 2 mL of the culture medium. The cells were then added to 24-well plates and kept for 24 h at 37 °C in 5% CO2. Next, the supernatant was collected and stored frozen until analysis for cytokines. Beta-2 microglobulin gene (β2M) as the control along with IL-23 and IL-8 was measured by the real-time PCR.

3.4. RNA Extraction and Complementary DNA Synthesis

Total RNA was extracted using Tripura according to the Roche Company protocol (CAT number 11667157001). Complementary DNA (cDNA) synthesis was performed using the cDNA Synthesis Kit (Bioneer Company, Korea) according to its protocol. Real-time reverse transcriptase-PCR (real-time RT-PCR) analysis with the TaqMan Real-time RT-PCR was used to investigate the expression of β2M as the reference gene (Figure 1), as well as IL-8 and IL-23 (Figures 2 and 3). The qPCRs were performed in a 10-μL volume consisting of 2 μL of cDNA target, 4 μL of each primer (10 pmol) (Table 1), 2.2 μL of distilled water, and 5 μL of TaqMan supermix (Bio-Rad). Reactions were run on the Light Cycler 480 system (Roche). The thermal cycling conditions were as follows: 94°C for 3 min, 35 cycles at 94°C for 15 s, 60°C for 30 s, and 60°C for 30 s.

Representative standard curves for the β2M gene using the Light Cycler device
Figure 1. Representative standard curves for the β2M gene using the Light Cycler device
Representative standard curves for IL-8 using the Light Cycler device. All samples are shown in duplicate.
Figure 2. Representative standard curves for IL-8 using the Light Cycler device. All samples are shown in duplicate.
Representative standard curves for IL-23 using the Light Cycler device. All samples are shown in duplicate.
Figure 3. Representative standard curves for IL-23 using the Light Cycler device. All samples are shown in duplicate.
Table 1. Primer Sequences (5’→ 3’) of IL- 8, IL-23, and β2M Used in the Real-time PCR
Primer SequencesLength
β2M
Forward: TTGTCTTTCAGCAAGGACTGG
Reverse: CCACTTAACTATCTTGGGCTGTG
IL- 877 bp
Forward: CGGAAGGAACCATCTCACTGTG
Reverse: AGAAATCAGGAAGGCTGCCAAG
Probe: TGACTTCCAAGCTGGCCGTGGCTC
IL-23122 bp
Forward: GCCTTCTCTGCTCCCTGATAG
Reverse: TGGGACTGAGGCTTGGAATC
Probe: TCTCCCAGTGGTGACCCTCAGGCT

3.5. Statistical Analysis

The normality of quantitative data was assessed by the Shapiro-Wilk test. The mean/standard deviation (SD) was used for normally distributed quantitative variables and median/inter-quartile range (IQR) for non-normally distributed variables. For comparing quantitative data between the two groups, t-test or Mann-Whitney test was used based on the Shapiro-Wilk test P values using SPSS Statistics for Windows, version 16.0 (SPSS Inc., Chicago, ILL, USA). P values of < 0.05 were considered significant.

4. Results

Among suspected individuals who referred to the study setting, 25 (83%) patients were infected with L. major based on the appearance of the 615-bp band (Figure 4). These 25 patients (eight women (32%) and 17 men (68%) with a mean age of 32 ± 13 years) and 25 controls (matched for age, sex, and geographical location) were involved in further analysis.

Lanes 1, ladder 100 pb; lane 2, L. tropica (positive control); Lane 3 and 5, L. tropica, lane 6: negative control; lane 4, L. major.
Figure 4. Lanes 1, ladder 100 pb; lane 2, L. tropica (positive control); Lane 3 and 5, L. tropica, lane 6: negative control; lane 4, L. major.

The expression of IL-8 was significantly higher in the patient group than in the control group (P = 0.038). All samples were shown in duplicate with an SD of 0.3 for the patient group and SD of 0.041 for the control group (Figure 5). The median (IQR) and P values of IL-8 and IL-23 expression are shown in Table 2.

Table 2. Median (IQR) and P Values of IL-8 and IL-23 Expression in the Patient and Control Groups
PatientsControlsPV
MedianIQRMedianIQR
IL-80.390.920.030.110.02
IL230.130.430.110.610.48
Comparison of mRNA expression levels of IL-8 in patients and healthy controls in human peripheral blood mononuclear cells analyzed by the real-time PCR; significant differences at P &lt; 0.05.
Figure 5. Comparison of mRNA expression levels of IL-8 in patients and healthy controls in human peripheral blood mononuclear cells analyzed by the real-time PCR; significant differences at P < 0.05.

The locations of skin lesions are shown in Table 3. Lesions were most prevalent in hands (in 14 cases), faces, and feet. The median number (IQR) of lesions was 2 (2) in a range of 1 to 6 lesions. The location and the number of skin lesions had direct relationships with IL-8 expression. Patients with lesions in face and hand had significantly higher levels of IL-8 (P = 0.042). Finally, the expression of IL-23 was insignificantly higher in the patient group than in the control group (P = 0.48). All samples are shown in duplicate with an SD of 0.2 for the patient group and SD of 0.03 for the control group (Figure 6).

Table 3. Location of Skin Lesions in Patients with Cutaneous Leishmaniasis Caused by Leishmania major
LocationFrequencya
Face4 (16.0)
Body2 (8.0)
Hand8 (32.0)
Foot5 (20.0)
Face and hand2 (8.0)
Hand and foot4 (16.0)
Total25 (100.0)

aValues are expressed as No. (%).

Comparison of mRNA expression levels of IL-23 in patients and healthy controls in peripheral blood mononuclear cells analyzed by the real-time PCR.
Figure 6. Comparison of mRNA expression levels of IL-23 in patients and healthy controls in peripheral blood mononuclear cells analyzed by the real-time PCR.

5. Discussion

In this study, we evaluated the expression of IL-8 and IL-23 in patients infected with L. major. In a previous study, the level of IL-23 was significantly higher in the healing form of CL than in the non-healing form of lesions (P < 0.001) (11). It was shown that L. major strongly stimulated IL-17 and IL-23 could also induce the production of IL-17 (5). IL-17 contributes more than IFN-γ in the pathology and inflammation of experimental leishmaniasis in mice (12). In C57BL/6 mice, the secretion of IL-17A and IL-17F does not influence the disease progression. It appears that, depending on the genetic background, cytokines of the IL-17 family might be responsible for disease progression primarily in susceptible mice (13). IL-23 stimulated IL-17 production following disease progression to protect patients against Leishmania infection along with inflammatory responses (8, 11). IL-23 production by L. major in infected BALB/c mice maintains IL-17+ cells that influence disease progression via the regulation of neutrophil recruitment (8).

IL-8 has an important role in neutrophil recruitment. Neutrophils play a dual role at the site of infection with L. major. In susceptible mice, they decreased to 2% within 72 h post-infection but in resistant mice, they were detected for more than 10 days after parasite inoculation at the lesion site (14). Therefore, they can fight L. major in the early stages of infection. In another study, IL-8 was elevated by 22.5 folds in leishmaniasis patients caused by L. tropica compared to healthy individuals. (15). Moreover, neutrophil cells could promote L. major survival (16, 17). The higher number of polymorphonuclear cells was detected in the lesion site of L. major than in ulcers generated by other Leishmania spp. probably because of the higher levels of IL-8 mRNA within Zoonotic Cutaneous Leishmaniasis (ZCL).

It seems that the elevation of IL-8 is more important than the elevation of IFN-γ in the immunopathogenesis of ZCL (18). The level of IL-8 in visceral leishmaniasis elevated after infection and decreased 30 days after infection (19). In 1996, it was shown that the high expression of IL-8 was induced within one-hour post-infection with L. major (20). In another study, the level of IL-8 decreased after treatment of L. tropica. It seems that IL-8 is an effector cytokine of immune regulation in the progression of CL (21).

In addition, it was shown that infection with L. major could lead to the enhanced production of LTB4 (pro-inflammatory lipid mediator for the recruitment of neutrophils) along with IL-8 following acute inflammation (16). In an array study of immune responses against L. tropica, both IL-23 and IL-8 showed highly significant elevated expression, in agreement with histochemistry report that showed infiltration of neutrophils and strong IL-8 expression in lesion patients (15, 21). In our study, IL-23 was higher in the patient group than in controls but not significantly. Th17 activity may be more associated with L. tropica than with L. major.

We used the beta-2 microglobulin (β2-MG) gene as reference for the normalization of our method. Boeuf et al. in 2005 showed that β2-MG was a more suitable gene for data normalization in the real-time PCR than UBC and YWHAZ endogenous genes. They showed that β2-MG transcripts are stable with less than 12% variation, whereas transcript levels of UBC and YWHAZ had up to 47% of the variability. Thus, β2-MG can be chosen as a reliable internal standard gene for reference (22).

The limitations of the study included the unclear duration of lesions and the limited size of the sample. In addition, it would be better to evaluate immune responses in the site of infected tissue not in cells from the peripheral blood. The strong point of the study was the clarification of the roles of IL-8 and IL-23 in CL caused by L. major despite a few studies available. Performing further studies on the change of IL-23 expression after treatment of persistent CL lesions and changes of IL-8/IL-23 in patients with multiple widespread lesions is suggested in the future.

5.1. Conclusions

Since IL-23 as a pro-inflammatory cytokine did not change significantly in CL patients, the inflammation in this population might not be associated with Th17 activity. On the other hand, IL-8 expression was around seven times higher in CL patients than in healthy controls. Furthermore, as the higher mean number of lesions was associated with more IL-8 expression, it is more likely that neutrophils and lymphocytes both are responsible for the development and progression of CL. Taken together, these results demonstrate that neutrophils after being stimulated with the parasite content can release IL-8 and other neutrophil activators. In addition, chemoattractants can mediate monocyte and T cell accumulation (J. Clin. Invest. 1996, 97:1931 - 1941) at the site of inflammation, which can worsen the activities. In such a situation, neutrophils release the granule content including lytic enzymes and oxygen active radicals to the extracellular milieu when neutrophils are stimulated with IL-8.

Acknowledgements

Footnotes

References

  • 1.

    Peters NC, Egen JG, Secundino N, Debrabant A, Kimblin N, Kamhawi S, et al. In vivo imaging reveals an essential role for neutrophils in leishmaniasis transmitted by sand flies. Science. 2008;321(5891):970-4. doi: 10.1126/science.1159194. [PubMed: 18703742]. [PubMed Central: PMC2606057].

  • 2.

    Ribeiro-Gomes FL, Romano A, Lee S, Roffe E, Peters NC, Debrabant A, et al. Apoptotic cell clearance of Leishmania major-infected neutrophils by dendritic cells inhibits CD8(+) T-cell priming in vitro by Mer tyrosine kinase-dependent signaling. Cell Death Dis. 2015;6. e2018. doi: 10.1038/cddis.2015.351. [PubMed: 26658192]. [PubMed Central: PMC4720886].

  • 3.

    Duvallet E, Semerano L, Assier E, Falgarone G, Boissier MC. Interleukin-23: A key cytokine in inflammatory diseases. Ann Med. 2011;43(7):503-11. doi: 10.3109/07853890.2011.577093. [PubMed: 21585245].

  • 4.

    Fitch E, Harper E, Skorcheva I, Kurtz SE, Blauvelt A. Pathophysiology of psoriasis: Recent advances on IL-23 and Th17 cytokines. Curr Rheumatol Rep. 2007;9(6):461-7. [PubMed: 18177599]. [PubMed Central: PMC2893221].

  • 5.

    Anderson CF, Stumhofer JS, Hunter CA, Sacks D. IL-27 regulates IL-10 and IL-17 from CD4+ cells in nonhealing Leishmania major infection. J Immunol. 2009;183(7):4619-27. doi: 10.4049/jimmunol.0804024. [PubMed: 19748991]. [PubMed Central: PMC2749572].

  • 6.

    Goncalves-de-Albuquerque SDC, Pessoa ER, Trajano-Silva LAM, de Goes TC, de Morais RCS, da CC, et al. The equivocal role of Th17 cells and neutrophils on immunopathogenesis of leishmaniasis. Front Immunol. 2017;8:1437. doi: 10.3389/fimmu.2017.01437. [PubMed: 29163510]. [PubMed Central: PMC5670345].

  • 7.

    Norouzinezhad F, Ghaffari F, Norouzinejad A, Kaveh F, Gouya MM. Cutaneous leishmaniasis in Iran: Results from an epidemiological study in urban and rural provinces. Asian Pac J Trop Biomed. 2016;6(7):614-9. doi: 10.1016/j.apjtb.2016.05.005.

  • 8.

    Lopez Kostka S, Dinges S, Griewank K, Iwakura Y, Udey MC, von Stebut E. IL-17 promotes progression of cutaneous leishmaniasis in susceptible mice. J Immunol. 2009;182(5):3039-46. doi: 10.4049/jimmunol.0713598. [PubMed: 19234200]. [PubMed Central: PMC2658650].

  • 9.

    Verma S, Kumar R, Katara GK, Singh LC, Negi NS, Ramesh V, et al. Quantification of parasite load in clinical samples of leishmaniasis patients: IL-10 level correlates with parasite load in visceral leishmaniasis. PLoS One. 2010;5(4). e10107. doi: 10.1371/journal.pone.0010107. [PubMed: 20404924]. [PubMed Central: PMC2852412].

  • 10.

    Habibi GR, Khamesipour A, McMaster WR, Mahboudi F. Cytokine gene expression in healing and non-healing cases of cutaneous leishmaniasis in response to in vitro stimulation with recombinant gp63 using semi-quantitative RT-PCR. Scand J Immunol. 2001;54(4):414-20. [PubMed: 11555409].

  • 11.

    Tolouei S, Ghaedi K, Khamesipour A, Akbari M, Baghaei M, Hasheminia S, et al. IL-23 and IL-27 levels in macrophages collected from peripheral blood of patients with healing vs non-healing form of cutaneous leishmaniasis. Iran J Parasitol. 2012;7(1):18-25. [PubMed: 23133467]. [PubMed Central: PMC3488816].

  • 12.

    Gonzalez-Lombana C, Gimblet C, Bacellar O, Oliveira WW, Passos S, Carvalho LP, et al. IL-17 mediates immunopathology in the absence of IL-10 following Leishmania major infection. PLoS Pathog. 2013;9(3). e1003243. doi: 10.1371/journal.ppat.1003243. [PubMed: 23555256]. [PubMed Central: PMC3605236].

  • 13.

    Dietze-Schwonberg K, Lopez Kostka S, Lorenz B, Regen T, Waisman A, von Stebut E. IL-17A/F in Leishmania major-resistant C57BL/6 mice. Exp Dermatol. 2019;28(3):321-3. doi: 10.1111/exd.13896. [PubMed: 30703249].

  • 14.

    Charmoy M, Auderset F, Allenbach C, Tacchini-Cottier F. The prominent role of neutrophils during the initial phase of infection by Leishmania parasites. J Biomed Biotechnol. 2010;2010:719361. doi: 10.1155/2010/719361. [PubMed: 19884987]. [PubMed Central: PMC2768872].

  • 15.

    Katara GK, Raj A, Kumar R, Avishek K, Kaushal H, Ansari NA, et al. Analysis of localized immune responses reveals presence of Th17 and Treg cells in cutaneous leishmaniasis due to Leishmania tropica. BMC Immunol. 2013;14:52. doi: 10.1186/1471-2172-14-52. [PubMed: 24267152]. [PubMed Central: PMC3840658].

  • 16.

    Plagge M, Laskay T. Early production of the neutrophil-derived lipid mediators LTB4 and LXA4 Is modulated by intracellular infection with leishmania major. Biomed Res Int. 2017;2017:2014583. doi: 10.1155/2017/2014583. [PubMed: 29181388]. [PubMed Central: PMC5664244].

  • 17.

    Salei N, Hellberg L, Kohl J, Laskay T. Enhanced survival of Leishmania major in neutrophil granulocytes in the presence of apoptotic cells. PLoS One. 2017;12(2). e0171850. doi: 10.1371/journal.pone.0171850. [PubMed: 28187163]. [PubMed Central: PMC5302790].

  • 18.

    Boussoffara T, Boubaker MS, Ben Ahmed M, Mokni M, Guizani I, Ben Salah A, et al. Histological and immunological differences between zoonotic cutaneous leishmaniasis due to Leishmania major and sporadic cutaneous leishmaniasis due to Leishmania infantum. Parasite. 2019;26:9. doi: 10.1051/parasite/2019007. [PubMed: 30810524]. [PubMed Central: PMC6391896].

  • 19.

    Araujo-Santos T, Andrade BB, Gil-Santana L, Luz NF, Dos Santos PL, de Oliveira FA, et al. Anti-parasite therapy drives changes in human visceral leishmaniasis-associated inflammatory balance. Sci Rep. 2017;7(1):4334. doi: 10.1038/s41598-017-04595-8. [PubMed: 28659627]. [PubMed Central: PMC5489532].

  • 20.

    Badolato R, Sacks DL, Savoia D, Musso T. Leishmania major: Infection of human monocytes induces expression of IL-8 and MCAF. Exp Parasitol. 1996;82(1):21-6. doi: 10.1006/expr.1996.0003. [PubMed: 8617327].

  • 21.

    Kumar R, Bumb RA, Salotra P. Evaluation of localized and systemic immune responses in cutaneous leishmaniasis caused by Leishmania tropica: Interleukin-8, monocyte chemotactic protein-1 and nitric oxide are major regulatory factors. Immunology. 2010;130(2):193-201. doi: 10.1111/j.1365-2567.2009.03223.x. [PubMed: 20102417]. [PubMed Central: PMC2878464].

  • 22.

    Boeuf P, Vigan-Womas I, Jublot D, Loizon S, Barale JC, Akanmori BD, et al. CyProQuant-PCR: A real time RT-PCR technique for profiling human cytokines, based on external RNA standards, readily automatable for clinical use. BMC Immunol. 2005;6(1):5. doi: 10.1186/1471-2172-6-5. [PubMed: 15748278]. [PubMed Central: PMC555737].

  • COMMENTS

    LEAVE A COMMENT HERE: