Distribution of Virulence Genes in Moraxella catarrhalis Isolated from Clinical Samples in the North of Iran

AUTHORS

Mina Eghbali 1 , 2 , Majid Baserisalehi 3 , * , Masood Ghane 4

1 Department of Microbiology, Fars Science and Research Branch, Islamic Azad University, Marvdasht, Iran

2 Department of Microbiology, Shiraz Branch, Islamic Azad University, Shiraz, Iran

3 Department of Microbiology, Kazeron Branch, Islamic Azad University, Kazeron, Iran

4 Department of Microbiology, Tonekabon Branch, Islamic Azad University, Tonekabon, Iran

How to Cite: Eghbali M, Baserisalehi M, Ghane M. Distribution of Virulence Genes in Moraxella catarrhalis Isolated from Clinical Samples in the North of Iran, Iran Red Crescent Med J. Online ahead of Print ; 21(1):e84125. doi: 10.5812/ircmj.61381.

ARTICLE INFORMATION

Iranian Red Crescent Medical Journal: 21 (1); e84125
Published Online: February 3, 2019
Article Type: Research Article
Received: September 9, 2018
Revised: December 22, 2018
Accepted: December 25, 2018
Crossmark

Crossmark

CHEKING

READ FULL TEXT
Abstract

Background: Moraxella catarrhalis is an opportunistic bacterium that has pathogenicity in the human respiratory tract. The rates of colonization and infection of this bacterium are high in the respiratory tract of children and the elderly.

Methods: In this descriptive cross-sectional study conducted from April 2016 to March 2018, 400 samples were collected from patients with pharyngitis (n = 92), sinusitis (n = 85), otitis media (n = 43), respiratory failure (n = 60), and healthy individuals as the control group (n = 120) in the Northern part of Iran. The isolates were identified by phenotyping methods. Finally, the virulence genes in the isolates were detected by polymerase chain reaction (PCR) technique.

Results: Out of a total number of 400 samples, 32 samples (8%) were positive for M. catarrhalis. The frequency of this bacterium was found to be different in patients with pharyngitis as 5.44%, sinusitis as 8.24%, otitis media as 13.95%, respiratory failure as 15%, and in the control group as 4.16%. Since the P value from the Chi-square test was higher than 0.05, there was no relationship between the prevalence of M. catarrhalis and the type of the disease and control group. The PCR results showed that 100% of the isolates had mcaP, ompJ, and ompCD genes. However, the distribution of other virulence genes was varied.

Conclusions: Overall, our findings verified the existence of M. catarrhalis in patients with respiratory diseases. Therefore, the rapid identification and successful treatment can play an important role in preventing their spread. In addition, the results verified the high prevalence of virulence genes in M. catarrhalis isolates from patients compared to controls. Regarding the results of this study and by comparing with similar studies, it can be concluded that the frequency of pathogenic isolates may be different even in regions that are not geographically different.

Keywords

Colonization Gene, Respiratory Tract Infection Moraxella (Branhamella) catarrhalis Polymerase Chain Reaction Virulence

Copyright © 2019, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited

1. Background

In recent years, M. catarrhalis has emerged as a new pathogen and it is now considered an important cause of upper and lower respiratory tract infections in children and the elderly. M. catarrhalis is the third most commonly associated cause of otitis media in the world after Streptococcus pneumonia and Haemophilus influenzae. It is also the second most common cause of chronic respiratory tract obstruction (COPD), along with S. pneumonia. In addition, the bacterium is the cause of sinusitis, meningitis, conjunctivitis, endocarditis, bacteremia, septic arthritis, osteomyelitis, wound infection, and hospital infection. M. catarrhalis is the most common bacterium isolated from sputum, middle ear, sinus, oral, and throat swabs (1-3).

Since M. catarrhalis has been considered a harmless commensal bacterium for a long time, there is relatively little cognition about pathogenicity characteristics and its virulence factors. Generally, the pathogenicity of this bacterium, like other microorganisms, depends on the ability to escape from the host defense mechanisms and binding to cellular and mucus layer, as well (4). M. catarrhalis can attach to various types of cells, including bronchial epithelial cells, epithelial cells of the small airway, and type 2 alveolar cells (5, 6).

The adhesion factors of this bacterium that play a role in biofilm formation include Outer Membrane Proteins (OMPs), ubiquitous surface protein A (UspA), Hemagglutinin/Moraxella catarrhalis Immunoglobulin D-Binding Protein (MID/Hag), and M. catarrhalis Adherence Protein (McaP). Moreover, with the help of M. catarrhalis outer membrane protein B (copB), it is able to extract iron from the host cells (1, 7).

Despite the important role of this bacterium in human health, many laboratories do not usually report M. catarrhalis as a true pathogen when compared to S. pneumonia and H. influenza; so, epidemiological studies have been conducted on M. catarrhalis. In addition, the M. catarrhalis colonization may vary based on the geographical area, living conditions, smoking status, health conditions, and other factors (8).

2. Objectives

The aim of this study was to investigate the frequency of M. catarrhalis in patients with respiratory infections relative to a control group and determine the frequency of responsible virulence genes in isolated strains.

3. Methods

3.1. Sample Collection

In this descriptive cross-sectional study conducted from April 2016 to March 2018, sampling was performed on 92 patients with sore throat, 85 patients with chronic sinusitis, and 43 patients with otitis media from throat swabs, sinus secretion, and ear discharge, respectively. The patients were selected from among those referring to the infectious wards of government hospitals in cities of Western Mazandaran province in the North of Iran (Noshahr, Tonekabon, and Ramsar) after being diagnosed by specialists.

In addition, lung secretions of 60 patients with respiratory failure in the intensive care unit of the hospitals connected to ventilators for 48 hours were collected. Further, the sampling of nasal secretions and throat swabs was performed on 120 healthy people without symptoms of sore throat, sinusitis, and ear infection. The sample size was calculated using this formula:

Equation 1.

The inclusion criteria of the study included patients diagnosed with respiratory infections and one of the symptoms of a sore throat, middle ear infection, sinusitis, and respiratory failure by infectious disease specialists. Patients who were hospitalized the week before the sampling, those who had received antibiotics one week before the sampling, patients with underlying illness, chemotherapy, and immune deficiency were excluded.

The study was approved by the National Ethics Committee for Biomedical Research (Code of Ethics: IR.IAU.TON.REC.1397.022), and written consent was obtained from all participants. For the epidemiological study, the data for each person including age, gender, and history of antibiotic consumption in the last month were recorded.

Following the sample collection, the specimens were immediately inoculated in brain heart infusion broth, transferred to a private medical diagnostic laboratory (pasture-Tonekabon), and placed in a 37°C incubator for 24 hours for initial enrichment.

3.2. Isolation and Identification of M. catarrhalis

The isolation method of M. catarrhalis was based on the standard culture technique. After the incubation time completed, each sample was cultured on blood agar (Merck, Germany). The culture medium was then placed in a 37°C incubator for 24 - 48 hours. After this period, the plates were evaluated for the phenotypic examination of M. catarrhalis including microscopic appearance, gram staining, catalase, oxidase, nitrate reduction, DNase tests, and fermentation of glucose, lactose, and sucrose.

3.3. Identification of Virulence Genes

All strains of M. catarrhalis were isolated and identified by the phenotypic method based on the polymerase chain reaction (PCR) technique. For this purpose, the DNA was extracted from the DNA extraction kit (Isogen, Russia). To determine the concentration and purity of DNA, the optical absorption of the sample was evaluated at 260 and 280 nm wavelengths. In order to implement the PCR and the amplification of the M. catarrhalis virulence gene, forward and rivers primers (Table 1) were synthesized by Tag Copenhagen (Denmark) as described by Verhaegh et al. (9) and Hays et al. (10).

Table 1. Forward and Reverse Primer Sequences for the Amplification of the M. catarrhalis Virulence Genes
Primer’s Name3’ → 5’ SequenceGene
mcaP-FCGCAATAAAGATCACCATGCTTGmcaP
mcaP-RCGGGATCCCGCTGACACATTGCATTGATAAA
MCA-FCTAACGCTGCCATCAGCTATompJ
MCAT2-RGTTGCATTACGGCTGGTAAC
Mcat.ompCD.FACGCACTGGCAAGAAGCTAGAompCD
Mcat.ompCD.RGACCTGCACCAACCAAGACAT
McatHag-FGTCAGCATGTATCATTTTTTAAGGHag
McatHag-RTGAGCGGTAAATGGTTTAAGTG
McCOPB2-FGGCGTGCGTGTTGACCGTTTTGcopB
McCOPB2-RGTTTGGCAGGCGATAGGCGACAT
MeierRT-FCGTTATGCACTAAAAGAGCAGGTCuspA1
MeierRT-RGCATCTGACCAGCTTAGACCAATC
uspA2-FCGCTGTAACCAGTGCCATGAuspA2
uspA2-RACGATAGCCAGCACCGATAG

To perform the molecular study, each reaction was performed in a total volume of 25 µL containing 13 µL of molecular biology-grade water (Sigma Aldrich Company LTD., USA), 2.5 µL of 10 × PCR buffer (Geneall, Korea), 1 µL of 10 pmol of each primer, 1 µL of 10 mM dNTPs (Geneall, Korea), 0.5 µL of smart taq DNA polymerase (Geneall, Korea), 1 µL of 50 mM MgCl2 (Geneall, Korea), and 5 µL of DNA template. The negative control tube contained the same PCR reagents as above-mentioned but had 5 µL of water substituted for the DNA template.

In the next step, the micro tip was mixed with the reaction mixture inside a thermal gradient cycler (Biorad, Germany). Then, PCR cycles started at 95°C for 45 s. The annealing temperature was set at 72°C for 60 s and then decreased by 1°C for each cycle until the temperature reached 55°C. The annealing temperature of 55°C was adjusted at 20 cycles, followed by the extension temperature of 72°C for 40 s and a final extension temperature of 72°C for 5 min.

An aliquot of all PCR products was run on a 2% (w/v) agarose gel with a 100 bp DNA ladder (Fermentas, Germany) and electrophoresed at 75 V for 40 min. The bands were visualized using ethidium bromide staining and photographed by a UV-transilluminator (UV DOC, England). In order to confirm the molecular results, the PCR products of each gene were sent to the Macrogene Corporation (South Korea) for DNA sequencing. All sequences data were subjected to BLAST analysis (http://www.ncbi.nlm.nih.gov/BLAST/) to definitively identify each gene amplicon.

3.4. Statistical Analysis of Data

In this study, Fisher and Chi-square tests in IBM SPSS Statistics for Windows, version 19.0 (IBM Corp., Armonk, N.Y., USA) were used to investigate the relationship between demographic factors and frequency of M. catarrhalis and the relationship between virulence genes and the type of diseases. The significance level of less than 0.05 was considered significant.

4. Results

4.1. Isolation of M. catarrhalis from Different Specimens

In this study, a total number of 400 samples were collected to identify M. catarrhalis in patients with respiratory diseases and healthy people during the period from April 2016 to March 2018. Overall, M. catarrhalis was present in 32 samples giving the frequency of 8%.

The frequency of this bacterium was found to be different in patients with pharyngitis as 5.44% (5 out of 92), sinusitis as 8.24% (7 out of 85), otitis media as 13.95% (6 out of 43), respiratory failure as 15% (9 out of 60), and in healthy controls as 4.16% (5 out of 120). The frequency distribution was analyzed by gender, age, and history of antibiotic use and the results can be seen in Table 2. The obtained data showed that 3.5% of women and 4.5% of men in the surveyed community were positive for M. catarrhalis. In addition, 1.25% of the patients under the age of 20, 1.75% in the age group of 21 - 40 years, 2% in the age group of 41 - 60 years, and 3% of the patients over the age of 60 were positive for this bacterium. In addition, 4.5% of the patients with M. catarrhalis had the history of antibiotic use in the month prior to sampling.

Table 2. The Frequency of M. catarrhalis Isolated from Samples of Patients with Respiratory Diseases and Healthy Controlsa
Demographic VariablePharyngitisSinusitisOtitis MediaRespiratory FailureControl Group
FrequencyPositivityFrequencyPositivityFrequencyPositivityFrequencyPositivityFrequencyPositivity
Gender
Female43 (46.74)2 (40)46 (54.12)3 (42.86)28 (65.12)4 (66.67)33 (55)4 (44.44)56 (46.66)1 (20)
Male49 (53.26)3 (60)39 (45.88)4 (57.14)15 (34.88)2 (33.33)27 (45)5 (55.56)64 (53.34)4 (80)
P valueb0.5620.4070.6560.3340.370
Age, y
< 2011 (11.96)2 (40)8 (9.41)2 (28.57)2 (4.65)-5 (8.33)-14 (11.66)1 (20)
21 - 4025 (27.17)1 (20)37 (43.53)3 (42.86)5 (11.63)1 (16.67)9 (15)1 (11.11)44 (36.66)1 (20)
41 - 6030 (32.61)1 (20)29 (34.12)1 (14.29)21 (48.84)4 (66.67)12 (20)2 (22.22)37 (30.84)-
> 6026 (28.26)1 (20)11 (12.94)1 (14.29)15 (34.88)1 (16.67)34 (56.67)6 (66.67)25 (20.84)3 (60)
P valueb0.3200.2260.6000.9420.066
History of antibiotic use
Yes48 (52.17)1 (20)61 (71.76)5 (71.43)36 (83.72)5 (83.33)42 (70)7 (77.78)18 (15)-
No44 (47.83)4 (80)24 (28.24)2 (28.57)7 (16.28)1 (16.67)18 (30)2 (22.22)102 (85)5 (100)
P valueb0.1890.6420.6810.4530.437
Total92 (100)5 (5.43)85 (100)7 (8.23)43 (100)6 (13.95)60 (100)9 (15)120 (100)5 (4.16)

aValues are expressed as No. (%).

bP < 0.05 was considered significant.

Since the P values from the Chi-square test for gender, age, antibiotic use history, and type of population under study were higher than 0.05, there was no relationship between the prevalence of M. catarrhalis and the type of disease and other demographic factors.

4.2. Evaluation of the Presence of Virulence Genes

The data obtained from the PCR and sequencing performed to determine the frequency of virulence genes in the isolated strains showed that 100% of the isolates (32 out of 32) had the mcaP, ompJ, and ompCD genes, 84.4% (27 of 32) had the Hag gene, 90.7% (29 of 32) had the copB gene, 96.9% (31 of 32) had the uspA1 gene, and 78.2% (25 of 32) had the uspA2 gene.

The frequency of different genes in the M. catarrhalis isolates in patients with respiratory infections and the control group can be seen in Table 3. As seen, in all strains isolated from patients and the control group, the mcaP, ompJ, and ompCD genes were present with a frequency of 100%. This is while the abundance of other genes was varied. The obtained data showed that although the frequency of the uspA1 gene was 100% in the patient group, the frequency of this gene (80%) was lower in healthy individuals (control group). In addition, the prevalence of uspA2, Hag, and copB genes in the healthy group (60%) was lower than the prevalence of the genes in M. catarrhalis isolated from patients with respiratory infections. Since the P value for each of the above genes from the Chi-square test is higher than 0.05, we can conclude that the relationship between the frequency of the virulence genes of M. catarrhalis and the type of the disease is not confirmed (Table 3).

Table 3. The Comparison of the Frequency of Virulence Genes among the Population in Positive Samplesa
Location of identificationmcaPompJompCDHagcopBuspA1uspA2
Pharyngitis
Positive5 (100)5 (100)5 (100)4 (80)4 (80)5 (100)3 (60)
Negative0 (-)0 (-)0 (-)1 (20)1 (20)0 (-)2 (40)
Sinusitis
Positive7 (100)7 (100)7 (100)6 (85.71)7 (100)7 (100)5 (71.43)
Negative0 (-)0 (-)0 (-)1 (14.29)0 (-)0 (-)2 (28.57)
Otitis media
Positive6 (100)6 (100)6 (100)5 (88.33)6 (100)6 (100)6 (100)
Negative0 (-)0 (-)0 (-)1 (16.67)0 (-)0 (-)0 (-)
Respiratory failure
Positive9 (100)9 (100)9 (100)9 (100)9 (100)9 (100)8 (88.89)
Negative0 (-)0 (-)0 (-)0 (-)0 (-)0 (-)1 (11.11)
Control group
Positive5 (100)5 (100)5 (100)3 (60)3 (60)4 (80)3 (60)
Negative0 (-)0 (-)0 (-)2 (40)2 (40)1 (20)2 (40)
P value---0.3170.1570.3080.364

aValues are expressed as No. (%).

5. Discussion

Given the fact that most respiratory infections are treated experimentally and without specific identification of the causative agent, the awareness of the prevalence of infectious organisms in each geographic region is important for an effective therapeutic approach. Since there is not enough information regarding the frequency and presence of pathogenic genes in M. catarrhalis in Iran, the present study can be considered a new study in the country.

As mentioned earlier, M. catarrhalis has the ability to colonize the respiratory tract without symptoms. Different studies have shown a high degree of M. catarrhalis colonization in children and healthy carriers. For example, Berner et al. (11), Masuda et al. (12), and Verhaegh et al. (9) reported the colonization rate of this bacterium in healthy children as 9%, 35%, and 29%, respectively. In the present study, the frequency of this bacterium in healthy carriers was estimated at 4.16%; the difference with previous studies may be due to the differences in geographic regions, seasons, and years of sampling.

In the present study, the prevalence of M. catarrhalis in patients with pharyngitis was 5.44%. Abuhammour et al. (13) also identified M. catarrhalis as one of the triggers for pharyngitis. Another study conducted by Heiniger et al. (14) for the identification of M. catarrhalis reservoirs in children’s pharynx lymph tissue showed a frequency of 80%.

On the other hand, in this study, from among 85 patients with sinusitis, this bacterium was isolated and identified in seven patients giving a frequency of 8.24%. In sinusitis, both in acute and chronic conditions, M. catarrhalis is the third most common cause of infection, and its prevalence may be up to 20% (15). In a study conducted by Gergova et al. (16) to determine the prevalence of M. catarrhalis in patients with sinusitis, the prevalence of the bacterium was reported as 39%.

As mentioned above, M. catarrhalis is known to be the third etiologic agent in the development of middle ear infection (17). In a study conducted by Sillanpaa et al. (8), the prevalence of the bacterium was 18.91%, which indicated the important role of the bacterium in the disease. In this study, from among 43 patients with otitis media, the bacterium was isolated and identified in six patients, with a frequency of 13.95%.

M. catarrhalis is also described as one of the main causes of lower respiratory tract infections. In this study, from among 60 patients with lower respiratory tract infection who were admitted to the intensive care unit, M. catarrhalis was isolated and identified in nine patients, giving a frequency of 15%.

Murphy and Parameswaran (18), Ramana and Chaudhury (19), Mohager et al. (20), and Eltaib et al. (3) reported that M. catarrhalis was isolated and identified in 1%, 3.75% 1%, and 8.9% of the patients, respectively. The reason for the difference in the prevalence of infection can be due to the different prevalence of the bacterium in different geographical areas, which has been well proven.

The colonization process of this bacterium in the respiratory tract without clinical symptoms until the development of a symptomatic disease is still not properly cleared. However, a number of bacterial factors that contribute to the pathogenesis have been identified. Some isolated strains have all of these factors. In contrast, some strains lack some of these factors. It is not clear, therefore, whether the expression of these factors would be the main cause of the disease. Environmental and host factors also play an important role in the progression of M. catarrhalis infection (21, 22).

The results showed that the frequency of the majority of virulence genes in the isolates of the control group was lower than that of the patients with respiratory infections, which can confirm that in addition to non-pathogenic strains that are lower in the respiratory tract of healthy people, there are some strains that acquire pathogenicity through the acquisition of pathogenic genes.

In a study conducted by Verhaegh et al. (9) to determine the frequency of virulence genes in M. catarrhalis isolated from children and adult with respiratory diseases, the prevalence of mcaP gene in 99% of the strains and the ompJ and ompCD genes in 100% of the isolates was observed, which is similar to the results of this study.

In another study conducted by Mollenkvist et al. (23) on the frequency of MID/Hag gene, it was shown that all strains (100%) isolated from various clinical conditions carried this gene. In another study conducted by Verhaegh et al. (7) on the genetic diversity of the strains of M. catarrhalis in 2011, from among 102 isolated strains, the presence of MID/Hag gene was confirmed in 85 strains, giving a frequency of 83%.

The majority of the studies have shown that all isolated strains have the copB gene. For example, Bootsma et al. (24) and Verhaegh et al. (9) by analyzing M. catarrhalis genes via molecular techniques reported a frequency of 100%. However, in studies conducted by Mitov et al. (25) and Liu et al. (26) on the distribution of pathogens responsible for the pathogenesis of M. catarrhalis, the results showed that this gene was present in 50% to 55% of the samples. The reason for this difference is not well understood; however, it can reflect the effect of different geographical regions in this context.

One of the other virulence factors of this bacterium is the uspA membrane proteins; owing to the presence of this factor, the bacterium can attach to the extracellular matrix of the opioid cells to facilitate the formation of biofilms (27). Several studies in this area have demonstrated a significant relationship between the presence of uspA1 and the potential for pathogenesis. The PCR results showed that 96.9% and 78.2% of the isolates carried uspA1 and uspA2 genes, respectively, which indicates the presence of this gene in isolated strains. The frequency of the outer membrane protein genes uspA1 and uspA2 has been reported in different studies. For example, Meier et al. (28) evaluated the frequency of uspA1 and uspA2 genes as 99% and 77%, respectively. Also, in another study by Verhaegh et al. (7) via genotyping of M. catarrhalis, children and adolescents with upper respiratory tract infections were identified to have a higher frequency for uspA1 gene (99%) compared to uspA2 (76%). In various studies conducted in different parts of the world, the high presence of uspA1 and uspA2 genes was reported in children with middle ear infection (29, 30), patients with pneumonia (31), and patients with COPD (29, 32).

Overall, our findings verified the existence of M. catarrhalis in patients with respiratory diseases. The PCR results showed that almost all of the isolates possessed virulence genes. Therefore, the rapid identification and successful treatment can play an important role in preventing their spread.

Footnotes

References

  • 1.

    Augustyniak D, Seredynski R, McClean S, Roszkowiak J, Roszniowski B, Smith DL, et al. Virulence factors of Moraxella catarrhalis outer membrane vesicles are major targets for cross-reactive antibodies and have adapted during evolution. Sci Rep. 2018;8(1):4955. doi: 10.1038/s41598-018-23029-7. [PubMed: 29563531]. [PubMed Central: PMC5862889].

  • 2.

    Prashanth HV, Dominic Saldanha RM, Shenoy S. Moraxella catarrhalis–A rediscovered pathogens. Int J Biol Med Res. 2011;2(4):979-81.

  • 3.

    Eltaib M, Elrhman A, Abdelhakam H, Khalid I, Abdelhalim A. Frequency of Moraxella catarrhalis from patients with lower respiratory tract infections in Khartoum state, Sudan. World J Pharma Res. 2015;4(5):2286-93.

  • 4.

    Liu G, Gradstedt H, Ermert D, Englund E, Singh B, Su YC, et al. Moraxella catarrhalis evades host innate immunity via targeting cartilage oligomeric matrix protein. J Immunol. 2016;196(3):1249-58. doi: 10.4049/jimmunol.1502071. [PubMed: 26712944].

  • 5.

    de Vries SP, Eleveld MJ, Hermans PW, Bootsma HJ. Characterization of the molecular interplay between Moraxella catarrhalis and human respiratory tract epithelial cells. PLoS One. 2013;8(8). e72193. doi: 10.1371/journal.pone.0072193. [PubMed: 23936538]. [PubMed Central: PMC3735583].

  • 6.

    Aebi C. Moraxella catarrhalis-pathogen or commensal? Adv Exp Med Biol. 2011;697:107-16.

  • 7.

    Verhaegh SJ, Snippe ML, Levy F, Verbrugh HA, Jaddoe VW, Hofman A, et al. Colonization of healthy children by Moraxella catarrhalis is characterized by genotype heterogeneity, virulence gene diversity and co-colonization with Haemophilus influenzae. Microbiology. 2011;157(Pt 1):169-78. doi: 10.1099/mic.0.042929-0. [PubMed: 20847012].

  • 8.

    Sillanpaa S, Oikarinen S, Sipila M, Kramna L, Rautiainen M, Huhtala H, et al. Moraxella catarrhalis might be more common than expected in acute otitis media in young finnish children. J Clin Microbiol. 2016;54(9):2373-9. doi: 10.1128/JCM.01146-16. [PubMed: 27413187]. [PubMed Central: PMC5005485].

  • 9.

    Verhaegh SJ, Streefland A, Dewnarain JK, Farrell DJ, van Belkum A, Hays JP. Age-related genotypic and phenotypic differences in Moraxella catarrhalis isolates from children and adults presenting with respiratory disease in 2001-2002. Microbiology. 2008;154(Pt 4):1178-84. doi: 10.1099/mic.0.2007/015057-0. [PubMed: 18375810].

  • 10.

    Hays JP, van Selm S, Hoogenboezem T, Estevao S, Eadie K, van Veelen P, et al. Identification and characterization of a novel outer membrane protein (OMP J) of Moraxella catarrhalis that exists in two major forms. J Bacteriol. 2005;187(23):7977-84. doi: 10.1128/JB.187.23.7977-7984.2005. [PubMed: 16291671]. [PubMed Central: PMC1291255].

  • 11.

    Berner R, Schumacher RF, Brandis M, Forster J. Colonization and infection with Moraxella catarrhalis in childhood. Eur J Clin Microbiol Infect Dis. 1996;15(6):506-9. [PubMed: 8839647].

  • 12.

    Masuda K, Masuda R, Nishi J, Tokuda K, Yoshinaga M, Miyata K. Incidences of nasopharyngeal colonization of respiratory bacterial pathogens in Japanese children attending day-care centers. Pediatr Int. 2002;44(4):376-80. doi: 10.1046/j.1442-200X.2002.01587.x. [PubMed: 12139560].

  • 13.

    Abuhammour WM, Abdel-Haq NM, Asmar BI, Dajani AS. Moraxella catarrhalis bacteremia: A 10-year experience. South Med J. 1999;92(11):1071-4. doi: 10.1097/00007611-199911000-00005. [PubMed: 10586832].

  • 14.

    Heiniger N, Spaniol V, Troller R, Vischer M, Aebi C. A reservoir of Moraxella catarrhalis in human pharyngeal lymphoid tissue. J Infect Dis. 2007;196(7):1080-7. doi: 10.1086/521194. [PubMed: 17763332].

  • 15.

    Bernhard S, Spaniol V, Aebi C. Molecular pathogenesis of infections caused by Moraxella catarrhalis in children. Swiss Med Wkly. 2012;142:w13694. doi: 10.4414/smw.2012.13694. [PubMed: 23136074].

  • 16.

    Gergova RT, Petrova G, Gergov S, Minchev P, Mitov I, Strateva T. Microbiological features of upper respiratory tract infections in bulgarian children for the period 1998-2014. Balkan Med J. 2016;33(6):675-80. doi: 10.5152/balkanmedj.2016.150116. [PubMed: 27994923]. [PubMed Central: PMC5156459].

  • 17.

    Perez AC, Murphy TF. A Moraxella catarrhalis vaccine to protect against otitis media and exacerbations of COPD: An update on current progress and challenges. Hum Vaccin Immunother. 2017;13(10):2322-31. doi: 10.1080/21645515.2017.1356951. [PubMed: 28853985]. [PubMed Central: PMC5647992].

  • 18.

    Murphy TF, Parameswaran GI. Moraxella catarrhalis, a human respiratory tract pathogen. Clin Infect Dis. 2009;49(1):124-31. doi: 10.1086/599375. [PubMed: 19480579].

  • 19.

    Ramana BV, Chaudhury A. Antibiotic sensitivity pattern of Moraxella catarrhalis at a tertiary care hospital. Int J of Pharm Life Sci. 2012;3(7):1805-6.

  • 20.

    Mohager MO, Hassan EI, Omer EI, Elmekki MA. Molecular detection of BRO β-lactamase gene of Moraxella catarrhalis isolated from Sudanese patients. Ann Trop Med Pub Health. 2013;6(441-5).

  • 21.

    Ramadan MO, Ibrahim IS, Shaheen AM, Ali WE. Significance of Moraxella catarrhalis as a causative organism of lower respiratory tract infections. Egypt J Chest Dis Tuberc. 2017;66(3):459-64. doi: 10.1016/j.ejcdt.2016.05.011.

  • 22.

    Singh B, Alvarado-Kristensson M, Johansson M, Hallgren O, Westergren-Thorsson G, Morgelin M, et al. The respiratory pathogen Moraxella catarrhalis targets collagen for maximal adherence to host tissues. MBio. 2016;7(2). e00066. doi: 10.1128/mBio.00066-16. [PubMed: 27006460]. [PubMed Central: PMC4807357].

  • 23.

    Mollenkvist A, Nordstrom T, Hallden C, Christensen JJ, Forsgren A, Riesbeck K. The Moraxella catarrhalis immunoglobulin D-binding protein MID has conserved sequences and is regulated by a mechanism corresponding to phase variation. J Bacteriol. 2003;185(7):2285-95. doi: 10.1128/JB.185.7.2285-2295.2003. [PubMed: 12644500]. [PubMed Central: PMC151486].

  • 24.

    Bootsma HJ, van Dijk H, Vauterin P, Verhoef J, Mooi FR. Genesis of BRO beta-lactamase-producing Moraxella catarrhalis: Evidence for transformation-mediated horizontal transfer. Mol Microbiol. 2000;36(1):93-104. doi: 10.1046/j.1365-2958.2000.01828.x. [PubMed: 10760166].

  • 25.

    Mitov IG, Gergova RT, Ouzounova-Raykova VV. Distribution of genes encoding virulence factors ompB2, ompCD, ompE, beta-lactamase and serotype in pathogenic and colonizing strains of Moraxella catarrhalis. Arch Med Res. 2010;41(7):530-5. doi: 10.1016/j.arcmed.2010.10.003. [PubMed: 21167392].

  • 26.

    Liu YL, Xiao M, Cheng JW, Xu HP, Xu ZP, Ye S, et al. Moraxella catarrhalis Macrolide-Resistant Isolates Are Highly Concentrated in Two MLST Clonal Complexes -CCN10 and CC363. Front Microbiol. 2017;8:201. doi: 10.3389/fmicb.2017.00201. [PubMed: 28239374]. [PubMed Central: PMC5300973].

  • 27.

    Blakeway LV, Tan A, Peak IRA, Seib KL. Virulence determinants of Moraxella catarrhalis: Distribution and considerations for vaccine development. Microbiology. 2017;163(10):1371-84. doi: 10.1099/mic.0.000523. [PubMed: 28893369].

  • 28.

    Meier PS, Troller R, Grivea IN, Syrogiannopoulos GA, Aebi C. The outer membrane proteins UspA1 and UspA2 of Moraxella catarrhalis are highly conserved in nasopharyngeal isolates from young children. Vaccine. 2002;20(13-14):1754-60. doi: 10.1016/S0264-410X(02)00030-0. [PubMed: 11906762].

  • 29.

    Lafontaine ER, Cope LD, Aebi C, Latimer JL, McCracken GH Jr, Hansen EJ. The UspA1 protein and a second type of UspA2 protein mediate adherence of Moraxella catarrhalis to human epithelial cells in vitro. J Bacteriol. 2000;182(5):1364-73. doi: 10.1128/JB.182.5.1364-1373.2000. [PubMed: 10671460]. [PubMed Central: PMC94425].

  • 30.

    Broides A, Dagan R, Greenberg D, Givon-Lavi N, Leibovitz E. Acute otitis media caused by Moraxella catarrhalis: Epidemiologic and clinical characteristics. Clin Infect Dis. 2009;49(11):1641-7. doi: 10.1086/647933. [PubMed: 19886799].

  • 31.

    Jordan KL, Berk SH, Berk SL. A comparison of serum bactericidal activity and phenotypic characteristics of bacteremic, pneumonia-causing strains, and colonizing strains of Branhamella catarrhalis. Am J Med. 1990;88(5A):28S-32S. doi: 10.1016/0002-9343(90)90258-F. [PubMed: 2111090].

  • 32.

    Pearson MM, Laurence CA, Guinn SE, Hansen EJ. Biofilm formation by Moraxella catarrhalis in vitro: Roles of the UspA1 adhesin and the Hag hemagglutinin. Infect Immun. 2006;74(3):1588-96. doi: 10.1128/IAI.74.3.1588-1596.2006. [PubMed: 16495530]. [PubMed Central: PMC1418653].

  • COMMENTS

    LEAVE A COMMENT HERE: