Platelet-Rich Plasma Accelerates Bone Differentiation in Human Adipose-Derived Mesenchymal Stromal Cells: An Experimental Study

AUTHORS

Maryam Cheraghzadeh 1 , Hana Hanaee-Ahvaz 2 , Alireza Kheirollah 3 , Hamid Galehdari 1 , *

1 Department of Genetics, Faculty of Science, Shahid Chamran University of Ahvaz, Ahvaz, Iran

2 Stem Cell Technology Research Center, Tehran, Iran

3 Department of Biochemistry, Medical School, Cellular and Molecular Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran

How to Cite: Cheraghzadeh M, Hanaee-Ahvaz H, Kheirollah A, Galehdari H. Platelet-Rich Plasma Accelerates Bone Differentiation in Human Adipose-Derived Mesenchymal Stromal Cells: An Experimental Study, Iran Red Crescent Med J. 2018 ; 20(12):e81828. doi: 10.5812/ircmj.81828.

ARTICLE INFORMATION

Iranian Red Crescent Medical Journal: 20 (12); e81828
Published Online: November 12, 2018
Article Type: Research Article
Received: July 7, 2018
Revised: October 14, 2018
Accepted: October 16, 2018
Crossmark

Crossmark

CHEKING

READ FULL TEXT
Abstract

Background: Mesenchymal stromal cells (MSCs) have high differentiation potential into different cell lines like osteoblasts. Osteogenic differentiation can be regulated through various and complex mechanisms, such as changing the microRNAs expression level. Although platelet-rich plasma (PRP) has been used in MSCs’ osteogenic differentiation process, the molecular mechanisms underlying the effect of PRP induction of osteogenesis by microRNAs is not well understood.

Objectives: We evaluated the effect of PRP on the expression of miR-29a, miR-29b, and miR-155 in the PRP-based osteogenic differentiation of human MSCs.

Methods: This experimental study was conducted on healthy individuals referred to Taleghani Hospital in Ahvaz, Iran, for abdominoplasty from September 2017 to April 2018. Stromal cells were isolated from human adipose tissue and differentiated into osteoblasts. Effect of 10% PRP on osteoblasts differentiation was monitored by the measurement of alkaline phosphatase activity and calcium deposition. We also evaluated gene expression of the Runx2 and the OPN along with the expression of miRNAs. All tests were performed in triplicate.

Results: Treatment of MSCs with 10% PRP resulted in induction of osteogenic differentiation by a significant upregulation of the miR-29a/b (miR-29a: 5.27 (0.77), P < 0.01 (day 3) and 3.76 (0.124), P < 0.01 (day 14); miR-29b: 3.11 (0.35), P < 0.001 (day 3) and 4.25 (0.304), P < 0.01 (day 14)) and a significant downregulation in the miR-155 expression (0.62 (0.006), P < 0.001 (day 3) and 0.55 (0.114), P < 0.05 (day 14)).

Conclusions: The remarkable rise in the expression of important osteoblast genes, alkaline phosphatase activity, and calcium deposition verified accelerated differentiation. The present study showed that microRNAs such as miR-29a/b and miR-155 play an active role in the process of bone differentiation during PRP treatment, which in turn, affects mesenchymal cells signaling pathways.

Keywords

Bone Differentiation Gene Expression Mesenchymal Stromal Cells MicroRNAs Osteoblasts Platelet-Rich Plasma

Copyright © 2018, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited

1. Background

Mesenchymal stromal cells (MSCs) are multipotent cells that differentiate into several classes of cell types, including adipocyte, osteoblast, chondrocyte, and endothelial cells (1, 2). Advantages of MSCs are their immunomodulatory properties, low graft-versus-host disease-responses, and simple and easy isolation (3). The International Society of Cellular Therapy (ISCT) recommends the following minimum criteria for MSC definition: (I) the adhesion ability to the plastic surface, (II) expression of surface markers such as CD37, CD90, and CD105 and non-expression of hematopoietic markers such as CD34, CD14, CD31, and CD45, and (III) the ability to differentiate into different cell types (4, 5).

MSCs can differentiate into chondrocytes and osteoblasts after recruitment to the injury site. They play a key role in bone repair and regeneration after injury and fracture (6, 7). Differentiation of stem cells results from highly regulated gene expression at the transcription or post-transcriptional levels, especially by microRNAs (8). MicroRNAs are transcribed either intergenic with an independent promoter or intragenic with the host promoter and play their inhibitory role generally by pairing with the 3'-end, or less commonly, with the 5'-end of mRNA (9). Bone-regulating miRNAs known as osteomiRs are expressed in the osteoblast cells that regulate bone formation by direct inhibition of osteoblast differentiation inhibitor genes or by responding to osteogenic signals such as bone morphogenetic proteins (BMP). To date, some microRNAs like let-7 family, miR-21, miR-16, miR-29 family, miR-155, miR-322, and miR-30 family have been reported to be involved in osteoblasts differentiation by regulating the expression of bone differentiation genes, such as osteocalcin (OCN), osteopontin (OPN), runt-related protein 2 (RUNX-2), collagen 1A (COL 1A), and alkaline phosphatase (ALP) (10-13).

MSCs are used for cell therapy in regenerative medicine, and direct injections of MSCs or cell-seeded scaffolds are administered to heal bone fractures, but the use of biological catalysts that accelerate this process is also improved (14). These catalysts should induce MSCs differentiation and proliferation while being cheap and biocompatible with no effects on the cellular and biological structure of mesenchymal cells (15). One of the most widely used catalysts is platelet-rich plasma (PRP), which was first described in 2007 as a plasma containing large amounts of growth factors (16). Recent reports refer to the presence of about 600 growth factors in PRP responsible for differentiation, tissue regeneration, and wound healing (17). These growth factors are released when platelets are activated by collagen, thrombin, serotonin, calcium, magnesium, thromboxane, or mechanical factors such as freezing cycles. Recently, PRP has been used in bone reconstruction and orthopedic surgery (15-18). Many studies have been undertaken on PRP and its role in facilitating bone differentiation and repair (19, 20), but how microRNAs’ profile is altered under its influence is poorly understood.

The present study aimed to investigate the expression of some miRNAs during differentiation of PRP-treated MSCs to better understand the molecular mechanisms of PRP. Since the changing of microRNAs profile on bone differentiation has been reported in several studies (15, 21, 22), the fact that how PRP alter the miRNA profile during bone differentiation is not well studied. Despite the large number of studies on animal models, there are limited studies on the application of PRP in human disease treatment. However, PRP treatment is still ongoing, and future research can fill the existing gaps.

2. Objectives

In this study, we aimed to address some of the ambiguities regarding PRP application in bone repair. The results of this study could be used to manipulate microRNAs to improve bone damages in the future.

3. Methods

3.1. Isolation and Activation of Platelet-Rich Plasma

This experimental study was conducted from September 2017 to April 2018 in Biochemistry Department of Jundishapur University of Ahvaz and Shahid Chamran University of Ahvaz, Iran. All the experiments were performed in three biological replications by calibrated instruments in three groups (i.e., Control, Osteogenic medium, and 10% PRP).

All the tests were in accordance with regulatory guidance and the Ethics Committee of Shahid Chamran University of Ahvaz (Ethical approval number: EE/96.24.3.88367/.scu.ac.ir).

Blood samples were collected from healthy volunteers in tubes containing anticoagulants, and then they were centrifuged at 1340 rpm in sterile conditions for 10 minutes. The layer containing the platelet was transferred to a new tube and centrifuged at 3000 rpm for 15 minutes. The platelet sediments were dissolved in platelet-poor plasma (PPP) and activated using 20% CaCl2 and incubating at -70ºC for two hours. Finally, the samples were centrifuged at 3000 rpm for 15 minutes and preserved at -70ºC until use.

3.2. Cell Isolation, Expansion, and Characterization

Adipose tissue samples were collected from healthy individuals undergoing abdominoplasty after obtaining their written consent according to the ethics committee of Shahid Chamran University of Ahvaz (Ahvaz, Iran). Cells isolation was carried out according to the previously published procedure (23). Briefly, the samples were washed to remove the blood cells, 1 mg/mL collagenase IV (Sigma) was added and the samples were incubated for 40 minutes at 37ºC. Collagenase was removed by centrifugation at 1200 rpm for 5 min. The isolated cells were cultured in Dulbecco’s modification of Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% pen/strep, and 1% amphotericin (Gibco). To confirm the differentiation potential of the isolated cells, adipogenic differentiation medium (0.5 mM IBMX, 10-7 mM dexamethasone, 66 nM insulin, and 0.2 mM indomethacin) and osteogenic medium (10-7 mM dexamethasone, 10 mM beta glycerol phosphate, and 50 μg/mL ascorbic acid bi-phosphate) were used, and then Oil Red staining (for lipids) and Alizarin Red staining (for osteoblasts) were carried out. Moreover, the expression levels of CD90, CD105, CD34, and CD45 was determined using flow cytometry.

3.3. Osteogenic Differentiation

Confluent cells between passages three and six were seeded in 6-well culture plates and provided with osteogenic medium (OM: 10-7 mM dexamethasone, 10 mM beta-glycerol phosphate, 50 μg/mL ascorbic acid bi-phosphate, in DMEM), 10% PRP group (10% of activated PRP in DMEM), and control group (10% FBS in DMEM), separately. The culture plates were incubated at 37ºC in 5% CO2 for 21 days.

3.4. Alkaline Phosphatase (ALP) Assay

Differentiated cells were lysed with RIPA buffer (cell signal) on days 3, 7 and 14 of osteogenic differentiation. The samples were incubated with an alkaline buffer solution and a phosphatase substrate solution (Pars Azmun, Iran) at 37ºC for 60 min. ALP activity was measured at 405 nm and normalized against total protein content. Protein content was measured by Lowry Protein Assay (BCA, Life Technologies).

3.5. Calcium Deposition Assay

For calcium deposition assay, differentiated cells were treated with 0.6 N HCl on days 3, 7 and 14 of bone differentiation. The amount of deposited calcium was determined using the Calcium Assay Kit (Pars Azmun, Iran) according to the manufacturers’ instruction. The results were normalized to total protein content.

3.6. miRNA and Total RNA Extraction, cDNA Synthesis, and Quantitative Real-Time PCR

Total RNA and miRNA were extracted using TRIzol (Invitrogen) and Qiagen RNeasy Plus Mini kit, respectively. Then, cDNA was synthesized using TAKARA cDNA synthesis kit, and miRNA first strand cDNA was synthesized by BONmiR kit (BONmiR, Iran) according to the manufacturer’s instruction. Finally, the expression of miRNAs and osteogenic genes in all the groups was calculated versus the control group with the comparative CT method (2-ΔΔCT) with U6 small nuclear RNA (snRNA) as the internal control for miRNAs and β2M for other genes. The specialty of signals was confirmed by melting curves. Primer sequences are shown in Table 1. Target genes of miRNAs were predicted by PicTar online software (https://pictar.mdc-berlin.de/; Table 2).

Table 1. Sequences of Human Primers Used for Quantitative Polymerase Chain Reaction
Gene NamePrimer Sequence
B2M
FATG CCT GCC GTG TGA AC
RATC TTC AAA CCT CCA TGA TG
OPN
FGACCTGACATCCAGTACCC
RGTTTCAGCACTCTGGTCATC
RUNX2
FGCC TTC AAG GTG GTA GCC C
RCGT TAC CCG CCA TGA CAG TA
SNORD
FATC ACT GTA AAA CCG TTC CG
RUniversal reverse primer under BONmiR patent
miR-29a
FCAT AGC ACC ATC TGA AAT CT
RUniversal reverse primer under BONmiR patent
miR-155
FACTTGGCTAATCGTGATAGT
RUniversal reverse primer under BONmiR patent
miR-29b
FTCACCGTTTGAAATCAGTGC
RUniversal reverse primer under BONmiR patent
Table 2. Predicted Target Genes
miRNAsPredicted Target Genes
miR-29aCOL1A1, COL4A5, COL4A5, COL4A5, SPARC, PCDHA11, SATB1, SPOCK2 (osteonectin)
miR-29bCXXC6, C1QTNF6, COL5A3, COL5A2, COL11A1, C1QTNF6, COL4A5, TRIB2, HAS3, TRAF4, SP1, COL4A3, BMP1, HDAC4, TGFB3, DUSP2, CTNNBIP1, PTEN
miR-155SOCS1, SATB1, ZNF537, BACH1, IKBKE,

3.7. Statistical Analysis

Statistical analyses were carried out by one-way analysis of variance (ANOVA) using SPSS Software, and P value less than 0.05 was considered significant. All the tests were run in triplicate. Data are shown as the mean ± standard deviation (± SD).

4. Results

The isolated cells showed fibroblast-like morphology (Figure 1) and could differentiate into two different lineages. Figure 2 shows Oil Red and Alizarin Red staining for adipocytes and osteoblasts, respectively.

Cells isolated from human adipose tissue on the first day (A), and seventh day (B) of primary culture (× 10)
Figure 1. Cells isolated from human adipose tissue on the first day (A), and seventh day (B) of primary culture (× 10)
Adipogenic differentiation performed by Oil Red staining (A), osteogenic differentiation performed by Alizarin Red staining (C), and negative control (B and D).
Figure 2. Adipogenic differentiation performed by Oil Red staining (A), osteogenic differentiation performed by Alizarin Red staining (C), and negative control (B and D).

While the expression of CD90 and CD105 was positive in the isolated cells (94.5% and 93.4%, respectively), the expression levels of CD34 and CD45 as hematopoietic markers were negligible (1.3% and 1.49%, respectively). These results confirmed the stemness properties of the isolated cells.

The activity of ALP and deposition of calcium were measured according to methods. ALP activity increased in OM and 10% PRP groups compared to controls, but the activity of ALP enzyme in 10% PRP was significantly higher than in OM at all the time points (Figure 3). Both PRP and OM groups led to deposition of calcium in the extracellular matrix and PRP had a significantly higher stimulatory effect on mineralization (Figure 4).

Expression of RUNX2 and OPN on the 14th day of osteoblast differentiation. All the differentiation groups showed significant differences with the control group (P ≤ 0.05). Abbreviations: OM, osteogenic medium; PRP, platelet-rich plasma.
Figure 3. Expression of RUNX2 and OPN on the 14th day of osteoblast differentiation. All the differentiation groups showed significant differences with the control group (P ≤ 0.05). Abbreviations: OM, osteogenic medium; PRP, platelet-rich plasma.
Characteristics of the alkaline phosphatase activity and calcium deposition in differentiation groups. All differentiation groups showed significant differences with the control group (P ≤ 0.05). Abbreviations: OM, osteogenic medium; PRP, platelet-rich plasma.
Figure 4. Characteristics of the alkaline phosphatase activity and calcium deposition in differentiation groups. All differentiation groups showed significant differences with the control group (P ≤ 0.05). Abbreviations: OM, osteogenic medium; PRP, platelet-rich plasma.

In all the studied groups, expressions of RUNX2 and OPN were up-regulated on the 14th day of differentiation, and 10% PRP had a higher stimulatory effect on OPN and RUNX2 expression than OM (Figure 3).

PRP alters miR-29a/b and miR-155 expression levels. miR-29a/b expression was increased in the 10% PRP and OM groups during osteoblast differentiation; however, the increased expression observed in the PRP group was significantly higher than in the OM group at different time points (days 3 and 14). The expression of miR-155 was down-regulated in both 10% PRP and OM groups on days 3 and 14 (Figure 5).

Relative expression of miR-155, miR-29a, and miR-29b on the 3rd and 14th days of osteoblast differentiation. (P ≤ 0.05). Abbreviations: OM, osteogenic medium; PRP, platelet-rich plasma.
Figure 5. Relative expression of miR-155, miR-29a, and miR-29b on the 3rd and 14th days of osteoblast differentiation. (P ≤ 0.05). Abbreviations: OM, osteogenic medium; PRP, platelet-rich plasma.

5. Discussion

Recently, PRP has been widely used as a therapeutic agent for some diseases and injuries like osteoarthritis and bone fractures. While the effects of PRP on bone marrow and adipose-derived MSCs have been extensively investigated (19, 20), the expression profile of miRNAs and other regulatory mechanisms of this substance have not been identified for bone differentiation. In this study for the first time, we aimed to investigate the expression of some important osteogenic microRNAs in PRP-based osteoblast differentiation.

Although some studies have used PRP along with the standard bone differentiation medium (OM) to induce differentiation (18, 24), we found that in the absence of the standard bone differentiation medium, PRP alone could induce bone differentiation. ALP activity and calcium deposition in the PRP group increased in the early days of differentiation compared to the OM group, which may be a marker of early differentiation. The higher mineralization and ALP activity in the 10% PRP group on the 7th and 14th days may be due to improved bone differentiation in comparison to the OM group. The expression of RUNX2 and OPN genes in the 10% PRP group increased by 2.9 and 4.2 times compared to the OM group, respectively. The results of alkaline phosphatase activity assay, the rate of calcification, and gene expression can be used to verify that activated PRP has a significant effect on the osteogenic differentiation of mesenchymal cells in vitro (Figures 3 and 4).

Different microRNAs can positively or negatively regulate bone differentiation by modifying signaling pathways (25). Wnt signaling pathways, which are the key pathways of bone development, induce miR29a expression, followed by inhibition of Wnt inhibitors (SFRP2, Kermen2, and DKK1) (26). The observed upregulation in miR-29a expression is probably related to the control of the Wnt inhibitor genes.

miR-155 is the negative regulator of bone morphogenetic proteins (BMP) signaling (27), and the results of the present study showed that miR-155 was significantly down-regulated in both OM and PRP groups on the 3rd and 14th days of differentiation, which confirms the inhibitory role of this miRNA in MSCs differentiation into osteoblasts.

The expression of bone differentiation inhibitor genes (HDAC4, TGFβ3, ACVR2A, CTNNBIP1, and DUSP2) is inhibited during the differentiation of MSCs (28). Our predictive analysis showed that these genes are targets for miR-29b, therefore, we suggest that the increased expression of miR-29b may inhibit these genes.

Mineral extracellular matrix (ECM) production is a late-onset event in bone differentiation, and the expression of collagen necessary genes such as COL1A1, COL3A1, and osteonectin is reduced during this stage to facilitate mineralization (28, 29). Due to the fact that these genes are predicted as the target genes for miR-29a and miR-29b and the expression of these miRNAs increases during days 3 to 14, the observed changes in the expression of this microRNA may cause inhibiting collagen genes and facilitating mineralization.

The limitations of this study were the assessment of cell differentiation only in two cell lines and only studying the expression of four stemness-related surface markers.

In sum, it can be suggested that PRP can improve the process of bone differentiation and facilitate mineralization due to changing the expression of different miRNAs in MSCs. Our subsequent studies will examine further miRNAs in order to clarify microRNAs expression profile during bone differentiation in PRP-treated MSCs.

Acknowledgements

References

  • 1.

    Garg P, Mazur MM, Buck AC, Wandtke ME, Liu J, Ebraheim NA. Prospective review of mesenchymal stem cells differentiation into osteoblasts. Orthop Surg. 2017;9(1):13-9. doi: 10.1111/os.12304. [PubMed: 28276640].

  • 2.

    Saeed H, Ahsan M, Saleem Z, Iqtedar M, Islam M, Danish Z, et al. Mesenchymal stem cells (MSCs) as skeletal therapeutics - an update. J Biomed Sci. 2016;23:41. doi: 10.1186/s12929-016-0254-3. [PubMed: 27084089]. [PubMed Central: PMC4833928].

  • 3.

    Lindroos B, Suuronen R, Miettinen S. The potential of adipose stem cells in regenerative medicine. Stem Cell Rev. 2011;7(2):269-91. doi: 10.1007/s12015-010-9193-7. [PubMed: 20853072].

  • 4.

    Rubio-Azpeitia E, Andia I. Partnership between platelet-rich plasma and mesenchymal stem cells: In vitro experience. Muscles Ligaments Tendons J. 2014;4(1):52-62. [PubMed: 24932448]. [PubMed Central: PMC4049651].

  • 5.

    Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The international society for cellular therapy position statement. Cytotherapy. 2006;8(4):315-7. doi: 10.1080/14653240600855905. [PubMed: 16923606].

  • 6.

    Knight MN, Hankenson KD. Mesenchymal stem cells in bone regeneration. Adv Wound Care (New Rochelle). 2013;2(6):306-16. doi: 10.1089/wound.2012.0420. [PubMed: 24527352]. [PubMed Central: PMC3842877].

  • 7.

    Dimitriou R, Tsiridis E, Giannoudis PV. Current concepts of molecular aspects of bone healing. Injury. 2005;36(12):1392-404. doi: 10.1016/j.injury.2005.07.019. [PubMed: 16102764].

  • 8.

    Hakelien AM, Bryne JC, Harstad KG, Lorenz S, Paulsen J, Sun J, et al. The regulatory landscape of osteogenic differentiation. Stem Cells. 2014;32(10):2780-93. doi: 10.1002/stem.1759. [PubMed: 24898411].

  • 9.

    Gulyaeva LF, Kushlinskiy NE. Regulatory mechanisms of microRNA expression. J Transl Med. 2016;14(1):143. doi: 10.1186/s12967-016-0893-x. [PubMed: 27197967]. [PubMed Central: PMC4873990].

  • 10.

    Lian JB, Stein GS, van Wijnen AJ, Stein JL, Hassan MQ, Gaur T, et al. MicroRNA control of bone formation and homeostasis. Nat Rev Endocrinol. 2012;8(4):212-27. doi: 10.1038/nrendo.2011.234. [PubMed: 22290358]. [PubMed Central: PMC3589914].

  • 11.

    Wang N, Zhou Z, Liao X, Zhang T. Role of microRNAs in cardiac hypertrophy and heart failure. IUBMB Life. 2009;61(6):566-71. doi: 10.1002/iub.204. [PubMed: 19472179].

  • 12.

    Hu YB, Li CB, Song N, Zou Y, Chen SD, Ren RJ, et al. Diagnostic value of microRNA for Alzheimer's disease: A systematic review and meta-analysis. Front Aging Neurosci. 2016;8:13. doi: 10.3389/fnagi.2016.00013. [PubMed: 26903857]. [PubMed Central: PMC4746262].

  • 13.

    Giza DE, Vasilescu C, Calin GA. Key principles of miRNA involvement in human diseases. Discoveries (Craiova). 2014;2(4). e34. doi: 10.15190/d.2014.26. [PubMed: 26317116]. [PubMed Central: PMC4547364].

  • 14.

    Mao AS, Mooney DJ. Regenerative medicine: Current therapies and future directions. Proc Natl Acad Sci U S A. 2015;112(47):14452-9. doi: 10.1073/pnas.1508520112. [PubMed: 26598661]. [PubMed Central: PMC4664309].

  • 15.

    Fernandes G, Yang S. Application of platelet-rich plasma with stem cells in bone and periodontal tissue engineering. Bone Res. 2016;4:16036. doi: 10.1038/boneres.2016.36. [PubMed: 28018706]. [PubMed Central: PMC5153571].

  • 16.

    Schwartz-Arad D, Levin L, Aba M. [The use of platelet rich plasma (PRP) and platelet rich fibrin (PRP) extracts in dental implantology and oral surgery]. Refuat Hapeh Vehashinayim (1993). 2007;24(1):51-5. 84. Hebrew. [PubMed: 17615992].

  • 17.

    Yoshida K, Sumita Y, Marukawa E, Harashima M, Asahina I. Effect of platelet-rich plasma on bone engineering with an alloplastic substitute containing BMP2. Biomed Mater Eng. 2013;23(3):163-72. doi: 10.3233/BME-130741. [PubMed: 23629530].

  • 18.

    Rodriguez IA, Growney Kalaf EA, Bowlin GL, Sell SA. Platelet-rich plasma in bone regeneration: Engineering the delivery for improved clinical efficacy. BioMed Res Int. 2014;2014. doi: 10.1155/2014/392398'.

  • 19.

    Wei B, Huang C, Zhao M, Li P, Gao X, Kong J, et al. Effect of mesenchymal stem cells and platelet-rich plasma on the bone healing of ovariectomized rats. Stem Cells Int. 2016;2016:9458396. doi: 10.1155/2016/9458396. [PubMed: 27994625]. [PubMed Central: PMC5141561 publication of this paper].

  • 20.

    Xu FT, Li HM, Yin QS, Liang ZJ, Huang MH, Chi GY, et al. Effect of activated autologous platelet-rich plasma on proliferation and osteogenic differentiation of human adipose-derived stem cells in vitro. Am J Transl Res. 2015;7(2):257-70. [PubMed: 25901195]. [PubMed Central: PMC4399090].

  • 21.

    Mariner PD, Johannesen E, Anseth KS. Manipulation of miRNA activity accelerates osteogenic differentiation of hMSCs in engineered 3D scaffolds. J Tissue Eng Regen Med. 2012;6(4):314-24. doi: 10.1002/term.435. [PubMed: 21706778]. [PubMed Central: PMC3184319].

  • 22.

    Baglio SR, Devescovi V, Granchi D, Baldini N. MicroRNA expression profiling of human bone marrow mesenchymal stem cells during osteogenic differentiation reveals Osterix regulation by miR-31. Gene. 2013;527(1):321-31. doi: 10.1016/j.gene.2013.06.021. [PubMed: 23827457].

  • 23.

    Pakfar A, Irani S, Hanaee-Ahvaz H. Expressions of pathologic markers in PRP based chondrogenic differentiation of human adipose derived stem cells. Tissue Cell. 2017;49(1):122-30. doi: 10.1016/j.tice.2016.11.001. [PubMed: 27887732].

  • 24.

    Tavakolinejad S, Khosravi M, Mashkani B, Ebrahimzadeh Bideskan A, Sanjar Mossavi N, Parizadeh MR, et al. The effect of human platelet-rich plasma on adipose-derived stem cell proliferation and osteogenic differentiation. Iran Biomed J. 2014;18(3):151-7. [PubMed: 24842141]. [PubMed Central: PMC4048479].

  • 25.

    Chen Q, Shou P, Zheng C, Jiang M, Cao G, Yang Q, et al. Fate decision of mesenchymal stem cells: adipocytes or osteoblasts? Cell Death Differ. 2016;23(7):1128-39. doi: 10.1038/cdd.2015.168. [PubMed: 26868907]. [PubMed Central: PMC4946886].

  • 26.

    Kapinas K, Kessler C, Ricks T, Gronowicz G, Delany AM. miR-29 modulates Wnt signaling in human osteoblasts through a positive feedback loop. J Biol Chem. 2010;285(33):25221-31. doi: 10.1074/jbc.M110.116137. [PubMed: 20551325]. [PubMed Central: PMC2919085].

  • 27.

    Gu Y, Ma L, Song L, Li X, Chen D, Bai X. miR-155 inhibits mouse osteoblast differentiation by suppressing SMAD5 expression. Biomed Res Int. 2017;2017:1893520. doi: 10.1155/2017/1893520. [PubMed: 28473977]. [PubMed Central: PMC5394354].

  • 28.

    Li C, Zhang P, Gu J. miR-29a modulates tumor necrosis factor-alpha-induced osteogenic inhibition by targeting Wnt antagonists. Dev Growth Differ. 2015;57(3):264-73. doi: 10.1111/dgd.12207. [PubMed: 25846459].

  • 29.

    Kapinas K, Kessler CB, Delany AM. miR-29 suppression of osteonectin in osteoblasts: Regulation during differentiation and by canonical Wnt signaling. J Cell Biochem. 2009;108(1):216-24. doi: 10.1002/jcb.22243. [PubMed: 19565563]. [PubMed Central: PMC2888144].

  • COMMENTS

    LEAVE A COMMENT HERE: