IF: 0.644
REUTERS THOMSON

Toxoplasma gondii: The Prevalence and Risk Factors in HIV-Infected Patients in Fars Province, Southern Iran

AUTHORS

Nasir Arefkhah 1 , Bahador Sarkari 1 , 2 , * , Masood Afrashteh 1 , Zahra Rezaei 3 , Mona Dehghani 1

AUTHORS INFORMATION

1 Department of Parasitology and Mycology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran

2 Basic Sciences in Infectious Diseases Research Center, Shiraz University of Medical Sciences, Shiraz, Iran

3 Professor Alborzi Clinical Microbiology Research Center, Nemazee Hospital, Shiraz University of Medical Sciences, Shiraz, Iran

ARTICLE INFORMATION

Iranian Red Crescent Medical Journal: 20 (6); e66521
Published Online: September 3, 2018
Article Type: Research Article
Received: January 20, 2018
Revised: March 11, 2018
Accepted: April 27, 2018
Crossmark

Crossmark

CHEKING

READ FULL TEXT
Abstract

Background: Toxoplasma gondii is a zoonotic protozoan that threatens the health of the people infected with human immunodeficiency virus (HIV). HIV-positive subjects are at risk of cerebral toxoplasmosis.

Objectives: The current study was designed to find out the seroprevalence of toxoplasmosis in HIV-infected individuals in Fars province, in the South of Iran.

Methods: This cross-sectional study was performed on 251 HIV-infected individuals referred to Shiraz HIV/AIDS Research Center in Fars province, Southern Iran, in 2016. Blood samples (5 mL) were collected from each individual and sera as well as buffy coat were isolated from each sample. Demographic and HIV-associated data were obtained from the patients’ medical records. Anti-Toxoplasma antibodies (both IgG and IgM) were determined by ELISA, using a commercial kit. In addition, PCR, targeting a 529 bp gene of T. gondii was performed on the patients’ buffy coats for detection of Toxoplasma DNA.

Results: Anti-Toxoplasma antibodies were detected in the sera of 42 out of 251 (16.7%) HIV infected patients. Of these, 39 cases (15.5%) were seropositive only for IgG and 3 (1.2%) were positive only for IgM. Seropositive subjects mainly belonged to 40 - 49 year age group. None of the subjects were positive for Toxoplasma DNA when evaluated by the PCR. No significant associations were found between Toxoplasma seropositivity and gender, age, and CD4+ cell level (P > 0.05).

Conclusions: Findings of this study demonstrated a significant rate of seroprevalence of Toxoplasma in HIV infected subjects in Fars province, Southern Iran. The seropositive cases are at risk of Toxoplasma reactivation and subsequent cerebral encephalitis. Treatment and also prevention of toxoplasmosis in HIV positive people should be considered.

Keywords

HIV Polymerase Chain Reaction Risk Factors Seroepidemiologic Studies Toxoplasmosis

Copyright © 2018, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited
1. Background

Opportunistic infections are one of the most critical challenges in the management of HIV infected individuals which can cause morbidity and mortality in these patients. T. gondii, as a zoonotic protozoan with worldwide distribution, is one of the life-threatening obligate opportunistic pathogens in immunosuppressed patients (1, 2). Reactivation of latent toxoplasmosis appears in the form of encephalitis and also disseminated toxoplasmosis.

T. gondii is a food-borne protozoan, which usually infects humans through consumption of contaminated water and food, as well as through placental transmission (3, 4). Prevalence of T. gondii infection in HIV-positive subjects in different areas of the world depends on people’s dietary and cultural food habits as well as the climatic condition of the area. The global seropositivity of T. gondii among the HIV population is reported to be 35.8% (5). A higher rate of seropositivity for T. gondii in HIV-infected individuals have been reported from Brazil (80.0%), Morocco (62.1%), and Iran (55.1 %) (1, 6, 7). Both HIV and Toxoplasma infections are challenging health problems in Iran (4, 8-13). Coinfection of HIV/Toxoplasma in Iran ranged from 20% to as much as 95% in some areas (14-16). The highest rate of seropositivity to Toxoplasma in HIV-infected subjects (96.3%) has been reported from the Mazandaran province, in the north of the country, while lower prevalence has been reported from Tehran (49.75%) and also from Kurdistan province (19.1%), which is in the west of Iran (14-17).

The incidence of cerebral toxoplasmosis is an important health concern in HIV-positive patients in areas where co-infection of HIV/Toxoplasma is high. In a retrospective study on 208 HIV/AIDS patients in the south of Iran, four (10.4%) of the patients were reported to have Toxoplasma encephalitis (18). High prevalence of Toxoplasma infection in sheep and goat meats from the Fars province, southern Iran (19), as well as the abundant population of cats in the region increase the risk of toxoplasmosis in general population as well as in the HIV-infected individuals. The current study was justified by the lack of information regarding the prevalence of Toxoplasma among the HIV-infected patients in Fars province, in the south of Iran. Findings of this study might be used for the improvement of Toxoplasma surveillance in HIV-infected individuals in Iran and also in other countries within the region.

2. Objectives

The current study aimed to determine the seroprevalence of Toxoplasma and also to detect Toxoplasma DNA in buffy coats of HIV infected patients in the Fars province in the southwest of Iran.

3. Methods
3.1. Study Population

This cross-sectional study was performed on 251 HIV-infected individuals referred to Shiraz HIV/AIDS Research Center in the Fars province, southern Iran, from May until September 2016. This governmental referral center is affiliated to the Shiraz University of Medical Sciences and provides diagnostic and treatment services for HIV patients, which referred to the center from the entire region. The criteria for selecting the patients were having a positive ELISA and also western blotting tests for HIV and having a complete medical record. Those subjects with incomplete records were excluded from the study. Ethical Committee of Shiraz University of Medical Sciences approved the study (Ethical code: IR.SUMS.REC.1394.S858). The study entirely considered the key Ethical issues such as obtaining informed consent, building trust, and imposing no maltreatment on the participants. Fars province is considered as the focus of several important parasitic diseases in Iran (20-25).

3.2. Sampling

The sample size was calculated considering the seroprevalence of reference of 18%, confidence level of 95%, and a marginal error of 0.05, using the sample size calculation formula for cross-sectional studies. Considering these criteria, the required sample size was found to be 226 where we collectively enrolled 251 HIV infected patients that met the study criteria.

Five mL of blood samples were taken from each patient in K2-EDTA tubes (Pishtaz Teb Zaman Diagnostics, Iran). The fresh whole blood was centrifuged for 10 minutes at 800 g, and the sera and buffy coat layer were removed. While maintaining the cold chain, the samples were transferred to the Immunoparasitology Laboratory at Shiraz University of Medical Sciences (SUMS) and kept at -20°C until use. Demographic information along with HIV-associated data was obtained from the patient’s medical records.

3.3. Detection of Anti-Toxoplasma Antibodies

The presence of anti-Toxoplasma IgG and IgM antibodies were assessed by a commercial ELISA kit (Acon Biotech, Hangzhou, China), based on the manufacturer’s instructions. The level of IgG and IgM antibodies were measured at 450 and 630 nm, using a plate reader (BioTek; Winooski, Vermont, USA). Index value > 1.1 was regarded as positive. Index values less than 0.9 regarded as negative while those values between 0.9 and 1.1 were regarded as equivocal. Samples within the equivocal zone were re-tested.

3.4. PCR for Detection of Toxoplasma DNA

DNA was extracted from the buffy coat of the blood samples as previously described (10). Briefly, 250 µL of TNNT buffer (0.5% Tween 20, 0.5% Nonidet P-40, 10 mM NaOH, and 10 mM Tris pH: 7.2) and 10 µL of proteinase K (10 μg/mL) was added to the buffy coat and incubated overnight at 56°C. Then the phenol-chloroform extraction method was used for subsequent DNA extraction. The forward TOX4-(5’- CGCTGCAGGGAGGAAGACGAAAGTTG) and reverse TOX5-(5’- GCTGCAGACACAGTGCATCTGGATT) primers (Bioneer, Daejeon, Korea) were used for the amplification of a 529 base pair fragment of Toxoplasma, as previously described (17). Briefly, 10 ng of template DNA and 10 pmol of each primer were added to a 1x Taq DNA polymerase master mix (Ampliqon, Odense, Denmark) in a final volume of 25 µL. The PCR was performed with the Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) with the cycle program of 94°C for 5 minutes, 35 cycles at 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds, and an ending extension at 72°C for 10 minutes. The PCR products were analyzed by electrophoresis on a 1.5% agarose gel and stained with GelRed nucleic acid gel stain (GelRed®, Sigma-Aldrich, USA).

3.5. Statistical Analysis

Collected data were analyzed by SPSS statistical software, version 18.0 (SPSS Inc, Chicago, Ill., USA). Descriptive statistics were performed to indicate the frequencies of the data. The association between seroprevalence of toxoplasmosis and qualitative variables were assessed by Chi-square test. The significance level was defined as 0.05.

4. Results

Subjects of the study were 251 HIV positive patients including 158 (63.5%) males and 91 (36.5%) females (two missing gender value), aged 14 to 83 years old. The mean age of the subjects was 40.8 (± 9.72), and most of the cases were in the age groups of 30 - 49 years. The mean CD4+ cell level of the patients was 403 cell/μL; with 7.6% less than 200 cell/ μL.

4.1. Seroprevalence of Toxoplasmosis Among the HIV-Positive Subjects

Anti-Toxoplasma antibodies were detected in the sera of 42 out of 251 (16.7%) HIV infected patients. Out of these 42 subjects, 39 cases (15.5%) were seropositive for IgG and 3 (1.2%) were positive for IgM, whereas none of the patients were simultaneously positive for IgG and IgM antibodies. The seroprevalence rate was insignificantly higher in males (18.4%) in comparison with the females (13.2%). The highest rate of seropositivity, based on the age groups and the CD4+ level, was observed in the age group of 50 - 59 years and patients with a CD4+ level between 400 to 600 cells/μL. None of the samples was positive for Toxoplasma DNA when evaluated by PCR. No significant associations were found between Toxoplasma seropositivity and gender, age, and CD4+ cell level. Table 1 shows the demographic characteristics and relative seropositivity to Toxoplasma in the HIV-positive subjects in this study.

Table 1. Demographic Features of HIV Infected Patients and Relative Seropositivity to Toxoplasma in Fars Province, Southern Iran
CharacteristicsNo. (%)Seronegative (IgM or IgG)Seropositive (IgM or IgG)Seropositive (IgG)Seropositive (IgM)
Gender
Male158 (63.5)129 (81.6)29 (18.4)26 (16.5)3 (1.9)
Female91 (36.5)79 (86.8)12 (13.2)12 (13.2)0 (0.0)
Age (y)
< 3029 (11.6)26 (89.7)3 (10.3)3 (10.3)0 (0.0)
30 - 3997 (38.6)85 (87.6)12 (12.4)11 (11.3)1 (1.0)
40 - 4993 (37.1)74 (79.6)19 (20.4)17 (18.3)2 (2.2)
50 - 5915 (6.0)11 (76.5)4 (26.6)4 (26.7)0 (0.0)
> 6017 (6.8)13 (6.2)4 (23.5)4 (23.5)0 (0.0)
CD4+ levela
≤ 20019 (7.6)15 (78.9)4 (21.1)4 (21.1)0 (0)
201 - 40045 (17.9)37 (82.2)8 (17.8)7 (15.1)1 (2.2)
401 - 600114 (45.4)96 (84.2)18 (15.8)17 (14.9)1 (0.9)
≥ 60173 (29.1)61 (83.6)12 (16.4)11 (15.1)1 (1.4)

Abbreviations: ELISA; enzyme-linked immunosorbent assay; IgM: Immunoglobulin M; PCR: polymerase chain reaction.

a CD4+: CD4+ T cells.

5. Discussion

The current study investigated the prevalence of Toxoplasma among HIV-positive patients in the south of Iran, using serological and molecular (PCR) methods. The overall seroprevalence of toxoplasmosis in HIV positive cases in the study was 16.8%. Most of the seropositive subjects (15.8%) were positive for IgG, which indicates a previous infection. These patients were at risk of Toxoplasma encephalitis when their CD4+ level dropped below the 100 cells/μL, which is a threshold for reactivation of latent toxoplasmosis in HIV positive patients. Considering this point, seropositivity to Toxoplasma might have a predictive value for the primary diagnosis of Toxoplasma encephalitis. Moreover, the presence of IgM antibodies against T. gondii in 3 patients may indicate a recent infection, although in some patients, IgM antibodies may persist at a detectable level for a relatively long time, after Toxoplasma infection.

In this study, Toxoplasma DNA was not detected in the buffy coats of either seropositive or seronegative cases. The absence of T. gondii DNA in the buffy coat of HIV-infected individuals may be linked to the very low level of concentration of T. gondii DNA in these patients. This finding is somewhat similar to the two previous reports among HIV/AIDS patients from Sanandaj, west of Iran, and Jahrom, south of Iran, where only one patient tested positive for T. gondii DNA in each of these studies (14, 17). Protocol of DNA extraction, the PCR target gene, the employed primers, and even the volumes of blood samples can influence the sensitivity of the PCR assay for the detection of Toxoplasma DNA in a given sample, including buffy coat (26).

Studies on T. gondii HIV co-infection in different regions of Iran demonstrated a rate of 18% up to 96% (14, 16, 17). The seroprevalence rate of 16.8% in the present study is close to a previously conducted retrospective study in the south of Iran, based on patients’ records, which reported a seroprevalence of 18.2% for toxoplasmosis (18). The seroprevalence rate in the current study is also close to the study of Rostami et al. (17), in Sanandaj, Kurdistan province, and west of Iran, which reported a 19.1% seroprevalence rate for Toxoplasma in HIV positive patients. Dry climate in Sanandaj and semi-dry in Fars province could be attributed to the close prevalence rate of T. gondii infection in these two areas of Iran.

In comparison with other studies, the prevalence rate of Toxoplasma in the current study was lower than some of the studies on the HIV-positive population in Iran. For instance, two serological studies on HIV-positive infection in the northern part of Iran reported a prevalence rate of 96.3% and 77.4% (11, 16). In other studies from Tehran and Mashhad, prevalence rates of 49.75% and 47.7% have respectively been reported (15, 27). The prevalence rate of Toxoplasma in our study was also lower than some of the studies in other countries including Ethiopia (93.3%) (28), Ghana (57.6%) (29), in southern Thailand (36.3%) (30), and Indonesia (77.2%) (31).

Different factors may affect the variations in seroprevalence rate of toxoplasmosis in different areas of the country which are; food and cultural habits in a community, people lifestyles, climatic condition, geographical location, the density of cats in the environment, and also the sensitivity of the employed serological assays.

Prevalence of Toxoplasma infection in this study could be attributed to contamination of meat and also food habits in the area. A high prevalence of T. gondii infection was reported in food animals (19), reared turkeys (32), and also in different groups of human population in Fars province where the current study was conducted (13, 33).

The decrease of the CD4+ cell below 200 cells/μL is considered as one of the most risk factors for reactivation of toxoplasmosis in HIV positive patients, although reactivation of chronic toxoplasmosis in patients with the CD4+ level higher than 200 cells/μL has also been reported (34). In our study, 7.6% of the subjects had a CD4+ level below 200 cells/μL. Although no Toxoplasma encephalitis was recorded in the patients, they are at risk of Toxoplasma reactivation, especially when the CD4+ level dropped below the 100 cells/μL.

AS far as our knowledge, this is the first study conducted on HIV-infected individuals in Fars province in the south of Iran, using both molecular and serological methods. This can be considered as the main strength of the study. However, the study has several limitations, including the absence of proper clinical features of the patients and not using the real-time PCR, which is a more sensitive molecular method in comparison with conventional PCR for detection of Toxoplasma DNA.

5.1. Conclusions

Taken together, the findings of this study demonstrated a significant rate of seroprevalence of Toxoplasma in HIV infected subjects in Fars province, southern Iran. The seropositive cases are at risk of Toxoplasma reactivation and subsequent cerebral encephalitis. Treatment and also prevention of toxoplasmosis in HIV positive people should be considered. Furthermore, T. gondii antibodies should be screened in new patients who have recently been diagnosed as HIV patients. Necessary education should be given to HIV infected patients who are seronegative for toxoplasmosis for reducing the risk of acquiring toxoplasmosis.

Acknowledgements
Footnotes
References
  • 1. Ahmadpour E, Daryani A, Sharif M, Sarvi S, Aarabi M, Mizani A, et al. Toxoplasmosis in immunocompromised patients in Iran: A systematic review and meta-analysis. J Infect Dev Ctries. 2014;8(12):1503-10. doi: 10.3855/jidc.4796. [PubMed: 25500647].
  • 2. Pereira-Chioccola VL, Vidal JE, Su C. Toxoplasma gondii infection and cerebral toxoplasmosis in HIV-infected patients. Future Microbiol. 2009;4(10):1363-79. doi: 10.2217/fmb.09.89. [PubMed: 19995194].
  • 3. Sarkari B, Abdolahi Khabisi S. Severe congenital toxoplasmosis: A case report and strain characterization. Case Rep Infect Dis. 2015;2015:851085. doi: 10.1155/2015/851085. [PubMed: 25685568]. [PubMed Central: PMC4313519].
  • 4. Asgari Q, Fekri M, Monabati A, Kalantary M, Mohammadpour I, Motazedian MH, et al. Molecular genotyping of Toxoplasma gondii in human spontaneous aborted fetuses in Shiraz, southern Iran. Iran J Public Health. 2013;42(6):620-5. [PubMed: 23967430]. [PubMed Central: PMC3744259].
  • 5. Wang ZD, Wang SC, Liu HH, Ma HY, Li ZY, Wei F, et al. Prevalence and burden of Toxoplasma gondii infection in HIV-infected people: A systematic review and meta-analysis. Lancet HIV. 2017;4(4):e177-88. doi: 10.1016/S2352-3018(17)30005-X. [PubMed: 28159548].
  • 6. Addebbous A, Adarmouch L, Tali A, Laboudi M, Amine M, Aajly L, et al. IgG anti-Toxoplasma antibodies among asymptomatic HIV-infected patients in Marrakesh-Morocco. Acta Trop. 2012;123(1):49-52. doi: 10.1016/j.actatropica.2012.02.070. [PubMed: 22425678].
  • 7. Xavier GA, Cademartori BG, Cunha Filho NA, Farias NA. Evaluation of seroepidemiological toxoplasmosis in HIV/AIDS patients in the south of Brazil. Rev Inst Med Trop Sao Paulo. 2013;55(1):25-30. [PubMed: 23328722].
  • 8. Abdoli A. Neglected risk factors for HIV and Toxoplasma gondii co-infection. Lancet HIV. 2017;4(4). e152. doi: 10.1016/S2352-3018(17)30048-6. [PubMed: 28359447].
  • 9. Bagheri Amiri F, Mostafavi E, Mirzazadeh A. HIV, HBV and HCV coinfection prevalence in Iran: A systematic review and meta-analysis. PLoS One. 2016;11(3). e0151946. doi: 10.1371/journal.pone.0151946. [PubMed: 27031352]. [PubMed Central: PMC4816272].
  • 10. Barazesh A, Sarkari B, Mehrabi Sisakht F, Abdolahi Khabisi S, Nikbakht R, Ravanbod MR. Seroprevalence and molecular evaluation of toxoplasmosis in patients undergoing chemotherapy for malignancies in the Bushehr province, southwest Iran. Jundishapur J Microbiol. 2016;9(9). e35410. doi: 10.5812/jjm.35410. [PubMed: 27800144]. [PubMed Central: PMC5086028].
  • 11. Daryani A, Sarvi S, Aarabi M, Mizani A, Ahmadpour E, Shokri A, et al. Seroprevalence of Toxoplasma gondii in the Iranian general population: A systematic review and meta-analysis. Acta Trop. 2014;137:185-94. doi: 10.1016/j.actatropica.2014.05.015. [PubMed: 24887263].
  • 12. Ilami O, Sarkari B, Khosravani A, Tori MA, Hosseini Z. HIV seroprevalence among high-risk groups in Kohgiloyeh and Boyerahmad province, southwest of Iran, a behavioral surveillance survey. AIDS Behav. 2012;16(1):86-90. doi: 10.1007/s10461-010-9874-x. [PubMed: 21190072].
  • 13. Sarkari B, Shafiei R, Zare M, Sohrabpour S, Kasraian L. Seroprevalence and molecular diagnosis of Toxoplasma gondii infection among blood donors in southern Iran. J Infect Dev Ctries. 2014;8(4):543-7. doi: 10.3855/jidc.3831. [PubMed: 24727522].
  • 14. Rezanezhad H, Sayadi F, Shadmand E, Nasab SD, Yazdi HR, Solhjoo K, et al. Seroprevalence of Toxoplasma gondii among HIV patients in Jahrom, southern Iran. Korean J Parasitol. 2017;55(1):99-103. doi: 10.3347/kjp.2017.55.1.99. [PubMed: 28285515]. [PubMed Central: PMC5365268].
  • 15. Mohraz M, Mehrkhani F, Jam S, SeyedAlinaghi S, Sabzvari D, Fattahi F, et al. Seroprevalence of toxoplasmosis in HIV(+)/AIDS patients in Iran. Acta Med Iran. 2011;49(4):213-8. [PubMed: 21713730].
  • 16. Rahimi MT, Mahdavi SA, Javadian B, Rezaei R, Moosazadeh M, Khademlou M, et al. High seroprevalence of Toxoplasma gondii antibody in HIV/AIDS individuals from north of Iran. Iran J Parasitol. 2015;10(4):584-9. [PubMed: 26811725]. [PubMed Central: PMC4724835].
  • 17. Rostami A, Keshavarz H, Shojaee S, Mohebali M, Meamar AR. Frequency of Toxoplasma gondii in HIV positive patients from west of Iran by ELISA and PCR. Iran J Parasitol. 2014;9(4):474-81. [PubMed: 25759728]. [PubMed Central: PMC4345086].
  • 18. Davarpanah MA, Mehrabani D, Neirami R, Ghahremanpoori M, Darvishi M. Toxoplasmosis in HIV/AIDS patients in Shiraz, southern Iran. Iran Red Crescent Med J. 2007;9(9):22-7.
  • 19. Asgari Q, Sarnevesht J, Kalantari M, Sadat SJ, Motazedian MH, Sarkari B. Molecular survey of Toxoplasma infection in sheep and goat from Fars province, southern Iran. Trop Anim Health Prod. 2011;43(2):389-92. doi: 10.1007/s11250-010-9704-1. [PubMed: 20936348].
  • 20. Sarkari B, Ahmadpour NB, Motazedian MH, Mirjalali H, Akhoundi M, Mohebali M, et al. Inter- and Intraspecific variations of Leishmania strains isolated from patients with cutaneous and visceral leishmaniases in Fars province, south of Iran. Iran J Med Sci. 2016;41(3):209-16. [PubMed: 27217605]. [PubMed Central: PMC4876299].
  • 21. Sarkari B, Gadami F, Shafiei R, Motazedian MH, Sedaghat F, Kasraian L, et al. Seroprevalence of Leishmania infection among the healthy blood donors in kala-azar endemic areas of Iran. J Parasit Dis. 2015;39(3):545-9. doi: 10.1007/s12639-013-0393-3. [PubMed: 26345068]. [PubMed Central: PMC4554570].
  • 22. Sarkari B, Hatam G, Ghatee M. Epidemiological features of visceral leishmaniasis in Fars province, southern Iran. Iran J Public Health. 2012;41(4):94-9. [PubMed: 23113170]. [PubMed Central: PMC3481615].
  • 23. Sarkari B, Hatam GR, Adnani SJ, Asgari Q. Seroprevalence of feline leishmaniasis in areas of Iran where Leishmania infantum is endemic. Ann Trop Med Parasitol. 2009;103(3):275-7. doi: 10.1179/136485909X398276. [PubMed: 19341541].
  • 24. Sarkari B, Naraki T, Ghatee MA, Abdolahi Khabisi S, Davami MH. Visceral leishmaniasis in southwestern Iran: A retrospective clinico-hematological analysis of 380 consecutive hospitalized cases (1999 - 2014). PLoS One. 2016;11(3). e0150406. doi: 10.1371/journal.pone.0150406. [PubMed: 26942443]. [PubMed Central: PMC4778872].
  • 25. Sarkari B, Ashrafmansori A, Hatam GR, Motazedian MH, Asgari Q, Mohammadpour I. Genotyping of Giardia lamblia isolates from human in southern Iran. Trop Biomed. 2012;29(3):366-71. [PubMed: 23018499].
  • 26. Ajzenberg D, Lamaury I, Demar M, Vautrin C, Cabie A, Simon S, et al. Performance testing of PCR assay in blood samples for the diagnosis of toxoplasmic encephalitis in AIDS patients from the French Departments of America and Genetic Diversity of Toxoplasma gondii: A prospective and multicentric study. PLoS Negl Trop Dis. 2016;10(6). e0004790. doi: 10.1371/journal.pntd.0004790. [PubMed: 27355620]. [PubMed Central: PMC4927177].
  • 27. Shafiei R, Riazi Z, Sarvghad M, Galian Sharifdini M, Mahmoodzadeh A, Hajia M. Prevalence of IgG and IgM anti-Toxoplasma gondii antibodies in HIV positive patients in northeast of Iran. Iran J Pathol. 2011;6(2):68-72.
  • 28. Shimelis T, Tebeje M, Tadesse E, Tegbaru B, Terefe A. Sero-prevalence of latent Toxoplasma gondii infection among HIV-infected and HIV-uninfected people in Addis Ababa, Ethiopia: A comparative cross-sectional study. BMC Res Notes. 2009;2:213. doi: 10.1186/1756-0500-2-213. [PubMed: 19852805]. [PubMed Central: PMC2770475].
  • 29. Pappoe F, Cheng W, Wang L, Li Y, Obiri-Yeboah D, Nuvor SV, et al. Prevalence of Toxoplasma gondii infection in HIV-infected patients and food animals and direct genotyping of T. gondii isolates, southern Ghana. Parasitol Res. 2017;116(6):1675-85. doi: 10.1007/s00436-017-5442-x. [PubMed: 28434050].
  • 30. Chemoh W, Sawangjaroen N, Siripaitoon P, Andiappan H, Hortiwakul T, Sermwittayawong N, et al. Toxoplasma gondii – prevalence and risk factors in HIV-infected patients from Songklanagarind Hospital, southern Thailand. Frontiers Microbiol. 2015;6. doi: 10.3389/fmicb.2015.01304.
  • 31. Ganiem AR, Dian S, Indriati A, Chaidir L, Wisaksana R, Sturm P, et al. Cerebral toxoplasmosis mimicking subacute meningitis in HIV-infected patients; a cohort study from Indonesia. PLoS Negl Trop Dis. 2013;7(1). e1994. doi: 10.1371/journal.pntd.0001994. [PubMed: 23326616]. [PubMed Central: PMC3542116].
  • 32. Sarkari B, Asgari Q, Bagherian N, Ashkani Esfahani S, Kalantari M, Mohammadpour I, et al. Molecular and serological evaluation of Toxoplasma gondii infection in reared Turkeys in Fars province, Iran. Jundishapur J Microbiol. 2014;7(7). e11598. doi: 10.5812/jjm.11598. [PubMed: 25368800]. [PubMed Central: PMC4216580].
  • 33. Sarkari B, Taghizadeh H, Shahriarirad R, Erfani A, Nekouei F, Seifbehzad S, et al. Seroepidemiological survey of toxoplasmosis among female university students in Shiraz, southern Iran. Ann Trop Med Public Health. 2017;10(2):362. doi: 10.4103/1755-6783.208724.
  • 34. Ghosn J, Paris L, Ajzenberg D, Carcelain G, Darde ML, Tubiana R, et al. Atypical toxoplasmic manifestation after discontinuation of maintenance therapy in a human immunodeficiency virus type 1-infected patient with immune recovery. Clin Infect Dis. 2003;37(7):e112-4. doi: 10.1086/378126. [PubMed: 13130422].
  • COMMENTS

    LEAVE A COMMENT HERE: