IF: 0.644
REUTERS THOMSON

Clinical and Genetic Characterization of Familial Adenomatous Polyposis: An Iranian Population Study

AUTHORS

Seyed Kazem Mirinezhad 1 , Seyed Yaqoob Moaddab 1 , Kourosh Masnadi Shirazi 1 , Morteza Jabbarpour Bonyadi 2 , Amir Taher Eftekharsadat 1 , Sosan Mir Najead Grami 1 , Mohammad Hossein Somi 1 , *

AUTHORS INFORMATION

1 Liver and Gastrointestinal Diseases Research Center, Tabriz University of Medical Sciences, Tabriz, IR Iran

2 Center of Excellent for Biodiversity, Faculty of Natural Sciences, University of Tabriz, Tabriz, IR Iran

How to Cite: Mirinezhad S K, Yaqoob Moaddab S, Masnadi Shirazi K, Jabbarpour Bonyadi M, Taher Eftekharsadat A, et al. Clinical and Genetic Characterization of Familial Adenomatous Polyposis: An Iranian Population Study, Iran Red Crescent Med J. 2018 ; 20(4):e64254. doi: 10.5812/ircmj.64254.

ARTICLE INFORMATION

Iranian Red Crescent Medical Journal: 20 (4); e64254
Published Online: July 8, 2018
Article Type: Research Article
Received: December 9, 2017
Revised: January 4, 2018
Accepted: January 23, 2018
Crossmark

Crossmark

CHEKING

READ FULL TEXT
Abstract

Background: Familial adenomatous polyposis (FAP) is an inherited autosomal dominant disorder, which can develop into cancer in early adulthood (100%) and is a result of germline mutations in the adenomatous polyposis coli (APC) genes.

Objectives: Identify APC germline mutations and assessed relationships between genotypes and phenotypes.

Methods: In a census-based cross-sectional study, FAP patients were selected from the referral medical centers of East Azarbaijan province between 2013 and 2016. Written informed consent was obtained from all patients for blood sampling and genetic testing. Patients undergo genetic counseling, and the pedigree was drawn. After peripheral blood sampling and DNA extraction, the potential mutation of the APC gene was detected by polymerase chain reaction (PCR), and DNA sequencing. Statistical tests were carried out using SPSS version 16.0. Categorical data between two groups were compared using the chi-square test. Independent sample t- test was used for comparison of continuous variables between two groups. The P-value < 0.05 was considered statistically significant.

Results: We identified APC gene mutations in 18 of the 30 unrelated patients with FAP (60%), including one novel frame shiftmutation, three nonsense mutations, and 14 novel missense mutations (78%). The most frequent mutations were in codon 1308 and 1350. Meanwhile, we found a novel polymorphism.

Conclusions: Our study results indicated that the APC gene has a high mutation detection rate (60%) between codons 999 and 1410, and codons 1308, and 1350 are two mutation hotspot regions.

Keywords

APC Gene Colorectal Cancer Correlation Familial Adenomatous Polyposis Genotype Iranian Population Phenotype

Copyright © 2018, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited

1. Background

Familial adenomatous polyposis (FAP) is an inherited autosomal disease, which can develop into cancer in early adulthood (100%) and is a result of germline mutations in the adenomatous polyposis coli (APC) genes (1). FAP has two phenotypes: classic form with more than 100 colorectal adenoma polyps and attenuated form (AFAP) with manifestations of 10-100 colorectal adenomas polyps (2, 3). Different extracolonic manifestations, including brain tumors, congenital hypertrophy of retinal pigment epithelium (CHRPE), upper gastrointestinal polyps, desmoid tumors, skin lesions, and other neoplasms may develop in patients with FAP (4-8). APC is located on the locus 5q21-22, consisting of 15 coding exons, which translate to a protein comprising 2843 amino acids (9). In the APC gene, hotspot mutation regions are located at the 5’ end of exon 15 at codons 1309 and 1061, which together make up approximately 33% of all APC mutations (10). The APC gene mutational cluster region (MCR) in Chinese and Western populations have been described between codons 849 and 1376 and between codons 1250 and 1464, respectively (11). The large size of the APC gene and high level of allelic heterogeneity are challenges of clinical laboratory tests for germline mutations in APC (3). The human gene mutation database (HGMD; accessed on February 2017) has introduced more than 1800 unique APC germline mutations. However, novel mutations are regularly found in continuing studies, caused by both proband ethnicity and nature of the gene itself (12, 13).

2. Objectives

In this study, we investigated 30 unrelated patients with FAP to identify APC germline mutations and assess the possible relationships between genotypes and phenotypes for the first time in East Azerbaijan Province-Iran.

3. Methods

3.1. Patients

In a census-based cross-sectional study, FAP patients were selected from the referral medical centers of East Azarbaijan province, Iran, between 2013 and 2016. Written informed consent was obtained from all patients for blood sampling and genetic testing. Patients undergo genetic counseling and pedigree were drawn. For unrelated FAP Patients, peripheral blood samples (3 mL) were taken in EDTA containing tubes and were stored at -80°C until DNA extraction. For clinical purposes, patients were classified by a gastroenterologist into two groups including attenuated FAP (presence of 10 to 100 adenoma type of polyps) and classic FAP (over 100 adenoma type of polyps). The flow chart of the patients was presented in Figure 1.

Flowchart of the patients studied.
Figure 1. Flowchart of the patients studied.
3.2. Mutation Analysis

Genomic DNA was extracted from EDTA anti-coagulant peripheral blood by the YTA kit (No.YT9040-Favor Gen -Taiwan) according to the manufacturer’s instructions. To detect APC mutations, the mutation region (codon 999 - 1410) was analyzed. Two pairs of primers (Gen Fanavaran Co. Iran) were designed based on the sequences published by Miyoshi et al. (1992) (14). To amplify a 1.2-kb region of exon 15; There were two overlapping PCR fragments. These primers cover more than 70% MCR in Western countries, MCR in the Chinese population, and between codons 849 and 1376 of the APC gene. Primers used are shown below: exon 15:

1) sense: 5’ TCAATACCCAGCCGACCT 3’, antisense-5’CAGCTGATGACAAAGATGAT3’.

2) sense- 5’GTAAGCCAGTCTTTGTGTC3’, antisense-5’ATGGTTCACTCTGAACGGA 3’.

The reaction was carried out in 25 µL volumes containing one microliter (100 ng) of genomic DNA, 5 microliter Taq DNA Polymerase Master Mix RED (AMPLIQON- AMITIS GEN CO.) and 10 pmol of each primer. The Thermocycler (Eppendorf AG, Germany) program included a hot start denaturation step at 95°C for 5 minutes, then 35 amplification cycles of denaturation at 95°C for 45 seconds, annealing at 57°C for exon 15 (1), 59°C for exons 15 (2) for 60 seconds, and elongation at 72°C for 45 seconds, followed by a final extension at 72°C for 7 minutes. After amplification, the purified PCR product was sequenced (Faza Pajooh Co. Iran), and sequence analyses Chromatogram were performed by Finch TV 1.4 software (Geospiza, Inc., Seattle, WA, USA). We excluded sequence reads with mapping quality value (MQV) less than 30 (15, 16). For identifying de novo mutations, we check them in two databases; universal mutation database (UMD) and human gene mutation database (HGMD).

3.3. Statistical Analysis

Statistical tests were carried out using SPSS software version 16.0 (SPSS Inc., Chicago, IL, USA). The Kolmogorov Smirnov test was used to determine data distribution. Categorical data between two groups were compared using the chi-square test. Independent sample t-test was used to compare continuous variables between two groups. The P-value < 0.05 was considered statistically significant.

The study was approved by the research ethics committee of Tabriz University of Medical Sciences (IR.TBZMED.REC.1394.210), Tabriz, Iran.

4. Results

Thirty patients were clinically diagnosed as having FAP, with the mean age of 31.77 years at disease onset (range, 17 - 60 years); also, 63.3% of the subjects were male. We identified 21 (70%) patients with classic FAP, seven of whom (33.3%) had no detectable mutations in APC. Thirteen FAP patients had coexisting colorectal cancer (CRC), seven of whom had APC mutations and six had no detectable APC mutations. Based on the findings, the most common extracolonic manifestation (ECM) was congenital hypertrophy of retinal pigment epithelium (CHRPE). It was reported in nine patients (30%), five of them were APC positive and four had no detectable APC mutations. The most common symptoms included gastrointestinal bleeding (40%); an APC mutation was detected in six patients (50%).Comparison of phenotypes of FAP with and without APC mutations revealed no significant relationship (Table 1). Genomic DNA sequencing of codon 999 to 1410 of APC gene was identified in 18 out of 30 unrelated patients with FAP, with a mutation rate of 60% (Table 2), including one novel frameshift mutation (6%; C.3416del A, P. K1139SfsX26), three nonsense mutations (17%; G4069T; P. G1357X, A3595T; p. K1199X and A4108T; p.K1370X), and 14 missense mutations (78%). Therefore, it was predicted that 22% of the mutations would cause truncation of the APC protein. Mutations at four sites were found in more than one FAP patients. The most frequent mutations were the heterozygous substitution A > G (AAA → GAA), which causes replacement of lysine with glutamine. These mutations occurred in codons 1308 (28%) and 1350 (22%). Two nonsense mutations were known, besides 16 (89%) novel mutations, as reported in the Universal Mutation Database (http://www.umd.be/APC/) and HGMD (http://www.hgmd.cf.ac.uk/ac/APC). Meanwhile, we found a novel heterozygote polymorphism in the two unrelated patients (C.3885 A>G, p.Glu1295Glu).

Table 1. Comparison of FAP Phenotypes Among Patients with and without APC Mutations
PhenotypesNo. of Patients (%)P Value
APC Mutation IdentifiedAPC Mutation Not Identified
Total no. patients18 (60)12 (40)
Onset (year)0.2a
Mean31.44 (18 - 51)32.25 (17 - 60)
Gender0.6b
Male12 (63.2)7 (36.8)
Female6 (54.5)5 (45.5)
FAP type0.2b
Classic FAP14 (66.7)7 (33.3)
Attenuated FAP4 (44.4)5 (55.6)
ECM0.8b
Gastroduodenal polyps2 (66.7)1 (33.3)
CHRPE5 (55.6)4 (44.4)
Desmoid tumor0 (0)1 (100)
Lipoma0 (0)1 (0)
Brain tumor1 (100)0 (0)
Colorectal cancer7 (53.8)6 (46.2)0.4b
First symptom0.08b
Abdominal pain9 (81.8)2 (18.2)
Gastrointestinal bleeding6 (50)6 (50)
Asymptomatic3 (42.9)4 (57.1)

Abbreviations: APC, adenomatous polyposis coli; CHRPE, congenital hypertrophy of retinal pigment epithelium; ECM, extracolonic manifestations; FAP, familial adenomatous polyposis.

a t-test.

b Chi-square.

Table 2. Clinical Phenotypes and Germline APC Mutations in Iranian (A) Patients with FAP
Patient IDDNA ChangeProtein ChangesMutation TypeFAP TypeOnset (year)First SymptomECMCRCKnown/New
13416delALys1139Serfs*26FrameshiftC40APCHRPE+New
73595 A>GLys1199Glut/acidMissenseC31APGDP+New
163595 A>TLys1199 stopNonsenseC25ASCHRPE-New
83868 A>GAsn1290AspMissenseC28AS--New
1, 8, 9, 17, 283922 A > GLys1308Glut/acidMissenseC,C,A,C,A40,28,40,28,23AP,AS,GB,AP,GBCHRPE ,-,-,-,-+,-, +, +, -New
53981 A > TSer1327SerSilentC19GB--New
5, 13982 C > GGln1328Glut/acidMissenseC,C19,40GB,AP-, CHRPE-, +New
23998 A > GLys1333ArgMissenseC42APCHRPE+New
284023 T > ASer1341ArgMissenseA23GB--New
264046 A>GHis1349ArgMissenseC29AP--New
19, 22, 26, 234048 A>GLys1350Glut/acidMissenseA,C,C,C51,20,29,44AP,AP,AP,APGDP,-,-, CHRPE-, +, -, +New
224069 G>TGly1357 stopNonsenseC20AP-+Known
184108 A>TLys1370 stopNonsenseC42GBCHRPE-Known
224137 G>AGlx1379GlxSilentC20AP-+New
64148 T>CMet1383ThrMissenseC28GB--New
274155 C>GSer1385ArgMissenseC18AP--New
124164 T>AThr1388ThrSilentA34GB--New
254176 A>GSer1392SerSilentC24APBrain tumor-New

Abbreviations: A, attenuated FAP; AP, abdominal pain; APC, adenomatous polyposis coli; AS, asymptomatic; C, classic FAP; CHRPE, congenital hypertrophy of retinal pigment epithelium; CRC, colorectal cancer; ECM, extracolonic manifestations; FAP, familial adenomatous polyposis; GB, gastrointestinal bleeding; GDP, gastroduodenal polyps.

5. Discussion

The genetic basis of classic and attenuated APC-associated colorectal adenomatous polyposis is a heterozygous germline mutation of the APC gene (17). In nearly 60 - 70% of FAP patients, micro mutations of APC gene were found. For determining the APC gene micromutations, direct DNA sequencing is the most reliable approach (18). Although studies have already been conducted on the germline APC mutation, information in the Iranian population is limited and scattered (19-21). This is a result of misdiagnosis and lack of laboratory facilities.

In the present study, the mutation rate was 60% higher than previous rates reported in Iran (27%) and Korea (33.3%), and was slightly higher than that reported in China (50%) (9, 22, 23). This difference in mutation rates might have resulted from different detection methods, sample size, and human subjects.

Studies conducted on Iranian populations from Northeast, Southwest, Central, and Northwest of Iran (the present study) indicates molecular heterogeneity in the APC gene (19-21).

5.1. Genotypes and Phenotypes

Although the association between germline APC and FAP phenotypes is well established, further definitions are necessary (24-26). We observed that a mutation in codon 1199 was associated with classic FAP, early disease onset, and prediction of truncated proteins. These features correlate with another previous report (Michils et al. in 2002) (27). The mutations in codons 1327, 1328, and 1385 were novel and related to the youngest age at diagnosis, reinforcing the notion that this region is associated with a classic phenotype. In this study, the mutations which predicted the results in the truncated protein were observed in classic FAP patients, which probably showed an association between the genotype and severity of polyposis (26). The mutations in codons 1308 (28%) and 1350 (22%) were observed in most patients in this study; therefore, they can be hotspot mutations in Iran. It is interesting that all those who had mutations in codon 1350 showed abdominal pain as the first symptom. We detected four attenuated forms of FAP with mutations in areas reportedly associated with the classic forms (between codons 1250 and 1464) (28). This finding agrees with previous studies and emphasizes on the need to include these areas in mutational screening of APC gene among AFAP patients (25). Extracolonic manifestations were identified in 15 (50%) out of 30 patients. This study showed a lower frequency of ECM in patients with APC-positive mutations (8/18; 44%) than those with APC-negative mutations (7/12; 58%). The most common ECM was CHRPE (nine patients), followed by gastroduodenal polyp (three patients), desmoid tumor (one patient), and lipoma (one patient). One patient had undergone an operation due to a brain tumor (schwannoma). Five out of 9 patients who presented with CHRPE had a detectable APC mutation between codons 1139 and 1370 and showed severe polyposis (Table 2). The location of the mutation in CHRPE was consistent with a previous report (29). Overall, there are controversies regarding the relationship between the severity of upper gastrointestinal polyposis and germline APC genotype (30, 31). In patients with classic and attenuated FAP with gastroduodenal polyps, APC gene mutations were in codons 1199 and 1350, respectively. These regions were inside the area reported previously (32). The relationship of colorectal polyposis with the brain tumors is attributed to Turcot’s syndrome. We observed that a young girl with classic FAP had a mutation in codon 1392. She had an unusual brain tumor located in the cerebellopontine angle. The pathological diagnosis was the schwannoma. However, the relationship between this mutation and schwannoma should be further investigated. The mutation in the desmoid tumor was beyond codon 1403 (25, 29); therefore, we did not find any mutation in the desmoid tumor. The mutations in codons 1139, 1199, 1328, 1333, 1350, and 1357 were responsible for the development of CRC (6/18) in the classic FAP phenotype, while the mutation in codon 1308 was responsible for the development of CRC in both classic and attenuated FAP. All of these mutations are novel, except for the mutation in codon 1357, which was previously described by Van der Luijt and colleagues, although they did not discuss colon cancer (33). This study had some limitations; the inability to find any “large rearrangements” in APC gene because these deletions or duplications are not identifiable by conventional sequencing techniques (34). We could not calculate associations between clinical variables and the identified APC germline mutations, a limitation of this study as the small sample size.

5.2. Conclusion

In conclusion, our study results indicate that the APC gene has a high mutation detection rate (60%) between codons 999 and 1410, and codons 1308 and 1350 are two mutation hotspot regions in Iranian patients with FAP.

Acknowledgements

References

  • 1. Leoz ML, Carballal S, Moreira L, Ocana T, Balaguer F. The genetic basis of familial adenomatous polyposis and its implications for clinical practice and risk management. Appl Clin Genet. 2015;8:95-107. doi: 10.2147/TACG.S51484. [PubMed: 25931827]. [PubMed Central: PMC4404874].
  • 2. Talseth-Palmer BA. The genetic basis of colonic adenomatous polyposis syndromes. Hered Cancer Clin Pract. 2017;15:5. doi: 10.1186/s13053-017-0065-x. [PubMed: 28331556]. [PubMed Central: PMC5353802].
  • 3. Kerr SE, Thomas CB, Thibodeau SN, Ferber MJ, Halling KC. APC germline mutations in individuals being evaluated for familial adenomatous polyposis: a review of the Mayo Clinic experience with 1591 consecutive tests. J Mol Diagn. 2013;15(1):31-43. doi: 10.1016/j.jmoldx.2012.07.005. [PubMed: 23159591].
  • 4. Nusliha A, Dalpatadu U, Amarasinghe B, Chandrasinghe PC, Deen KI. Congenital hypertrophy of retinal pigment epithelium (CHRPE) in patients with familial adenomatous polyposis (FAP); a polyposis registry experience. BMC Res Notes. 2014;7:734. doi: 10.1186/1756-0500-7-734. [PubMed: 25326340]. [PubMed Central: PMC4210554].
  • 5. Sloane J, Ranchod P, Williams G, Clark SK. Familial adenomatous polyposis: not all masses are desmoids. Fam Cancer. 2013;12(3):525-8. doi: 10.1007/s10689-012-9580-0. [PubMed: 23397065].
  • 6. Moussata D, Napoleon B, Lepilliez V, Klich A, Ecochard R, Lapalus MG, et al. Endoscopic treatment of severe duodenal polyposis as an alternative to surgery for patients with familial adenomatous polyposis. Gastrointest Endosc. 2014;80(5):817-25. doi: 10.1016/j.gie.2014.03.012. [PubMed: 24814771].
  • 7. Burger B, Cattani N, Trueb S, de Lorenzo R, Albertini M, Bontognali E, et al. Prevalence of skin lesions in familial adenomatous polyposis: a marker for presymptomatic diagnosis? Oncologist. 2011;16(12):1698-705. doi: 10.1634/theoncologist.2011-0244. [PubMed: 22135120]. [PubMed Central: PMC3248768].
  • 8. Syngal S, Brand RE, Church JM, Giardiello FM, Hampel HL, Burt RW, et al. ACG clinical guideline: Genetic testing and management of hereditary gastrointestinal cancer syndromes. Am J Gastroenterol. 2015;110(2):223-62. quiz 263. doi: 10.1038/ajg.2014.435. [PubMed: 25645574]. [PubMed Central: PMC4695986].
  • 9. Macrae F, du Sart D, Nasioulas S. Familial adenomatous polyposis. Best Pract Res Clin Gastroenterol. 2009;23(2):197-207. doi: 10.1016/j.bpg.2009.02.010. [PubMed: 19414146].
  • 10. Khan N, Lipsa A, Arunachal G, Ramadwar M, Sarin R. Novel mutations and phenotypic associations identified through APC, MUTYH, NTHL1, POLD1, POLE gene analysis in Indian Familial Adenomatous Polyposis cohort. Sci Rep. 2017;7(1):2214. doi: 10.1038/s41598-017-02319-6. [PubMed: 28533537]. [PubMed Central: PMC5440391].
  • 11. Yang J, Liu QW, Li LW, Wang QZ, Hong M, Dong J. Familial adenomatous polyposis in China. Oncol Lett. 2016;12(6):4877-82. doi: 10.3892/ol.2016.5330. [PubMed: 28105195]. [PubMed Central: PMC5228421].
  • 12. Tsukanov AS, Shubin VP, Pospekhova NI, Sachkov I, Kashnikov VN, Shelygin Y. Hereditary cancers of the gastrointestinal tract. Practical oncology. 2014. p. 126-33.
  • 13. Rivera B, Gonzalez S, Sanchez-Tome E, Blanco I, Mercadillo F, Leton R, et al. Clinical and genetic characterization of classical forms of familial adenomatous polyposis: a Spanish population study. Ann Oncol. 2011;22(4):903-9. doi: 10.1093/annonc/mdq465. [PubMed: 20924072].
  • 14. Miyoshi Y, Ando H, Nagase H, Nishisho I, Horii A, Miki Y, et al. Germ-line mutations of the APC gene in 53 familial adenomatous polyposis patients. Proc Natl Acad Sci U S A. 1992;89(10):4452-6. [PubMed: 1316610]. [PubMed Central: PMC49100].
  • 15. Shiraishi Y, Sato Y, Chiba K, Okuno Y, Nagata Y, Yoshida K, et al. An empirical Bayesian framework for somatic mutation detection from cancer genome sequencing data. Nucleic Acids Res. 2013;41(7). e89. doi: 10.1093/nar/gkt126. [PubMed: 23471004]. [PubMed Central: PMC3627598].
  • 16. Yap KL, Kiyotani K, Tamura K, Antic T, Jang M, Montoya M, et al. Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival. Clin Cancer Res. 2014;20(24):6605-17. doi: 10.1158/1078-0432.CCR-14-0257. [PubMed: 25316812]. [PubMed Central: PMC4268280].
  • 17. Rosenbluh J, Wang X, Hahn WC. Genomic insights into WNT/beta-catenin signaling. Trends Pharmacol Sci. 2014;35(2):103-9. doi: 10.1016/j.tips.2013.11.007. [PubMed: 24365576]. [PubMed Central: PMC3917662].
  • 18. Sheng JQ, Cui WJ, Fu L, Jin P, Han Y, Li SJ, et al. APC gene mutations in Chinese familial adenomatous polyposis patients. World J Gastroenterol. 2010;16(12):1522.
  • 19. Masjedizade A, Foroughmand A, Galedari H. [A study on mutations in hotspot sites of exon 15 of apc gene in familial adenomatous polyposis patients and their relatives in Iran Khuzestan province]. JSMJ. 2009. Persian.
  • 20. Hamzehloei T, Sarli A. Heteroduplex Analysis of Causative APC Mutations in FAP Patients Referred for Genetic Counseling in Mashhad Ghaem Hospital, Iran. Shiraz E Med J. 2013;14(4). doi: 10.17795/semj18537.
  • 21. Kishani Farahani R, Montazer Haghighi M, Asadzadeh Aghdaei H, Keshavarzi F, Taleghani MY, Goodarzi F, et al. Adenomatous polyposis coli gene large deletions in Iranian patients with familial adenomatous polyposis. Indian J Cancer. 2014;51(3):352-7. doi: 10.4103/0019-509X.146758. [PubMed: 25494137].
  • 22. Bafandeh Y, Daghestani D, Esmaili H, Aharizad S. Distribution of cancer and adenomatous polyps in the colorectum: study in an Iranian population. Asian Pac J Cancer Prev. 2006;7(1):65-8. [PubMed: 16629518].
  • 23. Jeon CH, Lee HI, Shin IH, Park JW. Genetic alterations of APC, K-ras, p53, MSI, and MAGE in Korean colorectal cancer patients. Int J Colorectal Dis. 2008;23(1):29-35. doi: 10.1007/s00384-007-0373-0. [PubMed: 17704924].
  • 24. Tao H, Shinmura K, Yamada H, Maekawa M, Osawa S, Takayanagi Y, et al. Identification of 5 novel germline APC mutations and characterization of clinical phenotypes in Japanese patients with classical and attenuated familial adenomatous polyposis. BMC Res Notes. 2010;3:305. doi: 10.1186/1756-0500-3-305. [PubMed: 21078199]. [PubMed Central: PMC2994888].
  • 25. Papp J, Kovacs ME, Matrai Z, Orosz E, Kasler M, Borresen-Dale AL, et al. Contribution of APC and MUTYH mutations to familial adenomatous polyposis susceptibility in Hungary. Fam Cancer. 2016;15(1):85-97. doi: 10.1007/s10689-015-9845-5. [PubMed: 26446593]. [PubMed Central: PMC4698287].
  • 26. Dodaro C, Grifasi C, Florio J, Santangelo ML, Duraturo F, De Rosa M, et al. The role of mutation analysis of the APC gene in the management of FAP patients. A controversial issue. Ann Ital Chir. 2016;87:321-5. [PubMed: 27682830].
  • 27. Michils G, Tejpar S, Fryns JP, Legius E, Van Cutsem E, Cassiman JJ, et al. Pathogenic mutations and rare variants of the APC gene identified in 75 Belgian patients with familial adenomatous polyposis by fluorescent enzymatic mutation detection (EMD). Eur J Hum Genet. 2002;10(9):505-10. doi: 10.1038/sj.ejhg.5200825. [PubMed: 12173026].
  • 28. Tsukanov AS, Pospekhova NI, Shubin VP, Kuzminov AM, Kashnikov VN, Frolov SA, et al. Mutations in the APC gene in Russian patients with classic form of familial adenomatous polyposis. Russ J Genet. 2017;53(3):369-75. doi: 10.1134/S1022795417030139.
  • 29. Galiatsatos P, Foulkes WD. Familial adenomatous polyposis. Am J Gastroenterol. 2006;101(2):385-98. doi: 10.1111/j.1572-0241.2006.00375.x. [PubMed: 16454848].
  • 30. Friedl W, Caspari R, Sengteller M, Uhlhaas S, Lamberti C, Jungck M, et al. Can APC mutation analysis contribute to therapeutic decisions in familial adenomatous polyposis? Experience from 680 FAP families. Gut. 2001;48(4):515-21. [PubMed: 11247896]. [PubMed Central: PMC1728231].
  • 31. Groves C, Lamlum H, Crabtree M, Williamson J, Taylor C, Bass S, et al. Mutation cluster region, association between germline and somatic mutations and genotype-phenotype correlation in upper gastrointestinal familial adenomatous polyposis. Am J Pathol. 2002;160(6):2055-61. doi: 10.1016/S0002-9440(10)61155-8.
  • 32. Nieuwenhuis MH, Vasen HF. Correlations between mutation site in APC and phenotype of familial adenomatous polyposis (FAP): a review of the literature. Crit Rev Oncol Hematol. 2007;61(2):153-61. doi: 10.1016/j.critrevonc.2006.07.004. [PubMed: 17064931].
  • 33. van der Luijt RB, Khan PM, Vasen HF, Tops CM, van Leeuwen-Cornelisse IS, Wijnen JT, et al. Molecular analysis of the APC gene in 105 Dutch kindreds with familial adenomatous polyposis: 67 germline mutations identified by DGGE, PTT, and southern analysis. Hum Mutat. 1997;9(1):7-16. doi: 10.1002/(SICI)1098-1004(1997)9:1<7::AID-HUMU2>3.0.CO;2-8. [PubMed: 8990002].
  • 34. Lucci-Cordisco E, Risio M, Venesio T, Genuardi M. The growing complexity of the intestinal polyposis syndromes. Am J Med Genet A. 2013;161A(11):2777-87. doi: 10.1002/ajmg.a.36253. [PubMed: 24124059].
  • COMMENTS

    LEAVE A COMMENT HERE: