A Study on in-vitro Transdifferentiation of Rat Bone Mar-row Stromal Cells into Neuroepithelial-Like Cells

This Article

Citations


Creative Commons License
Except where otherwise noted, this work is licensed under Creative Commons Attribution-NonCommercial 4.0 International License.

Article Information:


Group: 2009
Subgroup: Volume 11, Issue 2
Date: April 2009
Type: Original Article
Start Page: 133
End Page: 139

Authors:

  • GHR Kaka
  • Department of Anatomy,Tarbiat Modares University, Tehran, Tehran, Iran
  • Taki Tiraihi
  • Assistant Professor of Department of Anatomy, Tarbiat Modares University, Tehran, Tehran, Iran
  • J Arab Kheradmand
  • Department of Neurosurgery,Khatam-Al-Anbia Hospital, Shahed University, Tehran, Tehran
  • AR Azizzadeh Delshad
  • Department of Anatomy,Shahed University, Tehran, Tehran, Iran

      Correspondence:

      Affiliation: Assistant Professor of Department of Anatomy, Tarbiat Modares University
      City, Province: Tehran, Tehran
      Country: Iran
      Tel: +98-21-88790109
      Fax: +98-21-88678104
      E-mail: ttiraihi@yahoo.com

Abstract:


Background: Bone marrow stem cells (BMSCs) are a rich source of stem cells and may represent a valid alternative to neural or embryonic stem cells by replacing the autologous damaged tissues in neurodegenerative diseases. In this study, we attempted to devise a protocol for the induction of BMSCs into neuroepithelial-like cells (NELCs).

 

Methods: Rat BMSCs were isolated from the long bones of adult Sprague–Dawley rats. Their purity in the 4th passage was evaluated with fibronectin by immunocytochemistry, and the stemness marker Oct-4 was assessed by RT-PCR technique. The cells were expanded and induced in the induction stage. The BMSCs were incubated with either β-mercaptoethanol (βME) (1 mM), dimethyl sulfoxide (DMSO) (2%) or biotylated hydroxyanisol or butylated hydroxyanisol (BHA) (200 µM) in α-MEM medium without fetal bovine serum (FBS). They were washed with phosphate buffer saline (PBS) and proceeded to the 2nd phase of induction, where the induction medium was changed with α-MEM and 15% FBS containing all-trans retinoic acid (RA) (1 µM) (for 3 days). Then, the expression of the markers was assessed with GFAP, nestin and neurofilament 68 antibodies, respectively and the expression of Oct-4 and NeuroD was evaluated by RT-PCR.

 

Results: The purity of the BMSCs at the 4th passage was more than 92%. The mRNA of Oct-4 was expressed in these cells. Induction of BMSCs by DMSO-RA could differentiate NELCs significantly more than βME-RA and BHA-RA. The transdifferentiation of NELCs was evaluated by nestin antibody and NeuroD mRNA expression; later markers expressed very low detectable level in BMSCs. But the differentiation of BMSCs into astrocytes was less in all of the experiment groups that is estimated GFAP antibody.

 

Conclusion: The application of DMSO-RA can transdifferentiate BMSCs into NELCs in- vitro.

 

Keywords: Rat; BMSCs; Neuroepithelial-like cells; Transdifferentiation

Manuscript Body:


Introduction

 

The adult vertebrate's nervous system has a limited capacity to recover from insults or diseases that result in extensive neuronal or glial loss.1 The stem cells (SCs) are undifferentiated cells characterized2 by the capacity to either indefinite self-renewal or originating tissue-specific committed progenitors or differentiated cells.3 It has recently been established that in several tissues, adult stem cells may undergo a fate other than that usually manifested in physiological conditions. As an example, stem cells isolated from bone marrow stromal cells (BMSCs) can differentiate not only into blood cells, but also into hepatocytes,4 skeletal muscle,5 and cardiomyocytes.6 The ability of BMSCs to promote neurogenesis may be a component that assists in the functional recovery of the injured CNS.7 Even more surprisingly, recent in-vitro studies have shown that bone marrow stromal cells can differentiate into neuronal and glial cells depending on the growth conditions.8 BMSCs may represent a possible alternative to embryonic stem cells for cell therapy in replacing of dead neurons.9,10 Although the discovery of the existence of neural stem cells in the adult human brain is certainly a landmark in the field of cell therapy in CNS,11 it is difficult to devise a method leading to manipulation and reimplantation of the neural stem cells that can be taken directly from the patient's brain. Therefore, BMSCs offer, theoretically, unlimited therapeutical applications.

BMSCs can be isolated from the whole bone marrow as they adhere to plastic culture dishes. Recent studies have shown that BMSCs can be induced to express a neuronal phenotype in-vitro under specific experimental conditions. For example, Woodbury et al.12 observed that in the presence of β-mercaptoethanol and dimethyl sulfoxide, BMSCs may differentiate into cells expressing neuronal markers. Moreover, it has been reported that in the presence of epidermal growth factor (EGF) and brain-derived neurotrophic factor (BDNF), stromal cells differentiated into neural cells that expressed both neuronal and glial markers.13

The possibility of differentiating BMSCs into NELCs phenotype (neuro-glial progenitor cells are capable of giving rise to both differentiated neuronal and glial cells) would be an important step towards cell therapy for patients affected by neurodegenerative diseases.14 Therefore, we examined the different effects produced by three specific treatments in inducing differentiation of BMSC into neuroepithelial phenotype.

 

 

Materials and Methods

 

The experiments have been approved by the animal studies ethical committee at Tarbiat Modares University, School of Medical Sciences Tehran, Iran. The BMSCs were collected from the long bones of adult Sprague–Dawley rats at 25–30 days of age (Razi Institute, Tehran, Iran). They were sacrificed, and the tibias and the femurs were dissected. The proximal and distal ends were removed under aseptic conditions and the bone marrow was aspirated with 5 ml of α-MEM (Gibco, UK) containing 500 units of heparin, using a 21G needle. The cell pellet was obtained and containing haematopoietic cells, marrow stromal cells and others were suspended in α-MEM, 15% fetal bovine serum (FBS), 100 u/ml penicillin, 100 µg/ml streptomycin, 25 ng/ml amphotericin B and 2 mM L-glutamine. The harvested cells were seeded on a 75 cm2 flask (Nunc, Denmark) at 37 °C, 5% CO2 incubator for 24 hours. The flasks were washed with PBS in order to remove the haematopoietic cells. The cells were incubated for 2-3 days to reach the confluency. The cells were detached with 0.25% trypsin and 1 mM EDTA for 5-10 mins at 37 ºC in order to obtain a single-cell suspension. Nearly 5,000 cells/cm2 were replated in new gelatin-coated flasks or in 24-well plates containing gelatin-coated glass coverslip. This cycle was repeated four times (passage 1, 2, 3 and 4, respectively). At the 4th passage, the cells were checked for BMSCs purity using fibronectin immunostaining as well as Oct-4 RT-PCR on RNA extracts from the cultured cells.

The BMSCs were subjected to induction after 24 hours of the 4th passage; they were incubated with either β-mercaptoethanol (βME) (1 mM), dimethyl sulfoxide (DMSO) (2%) or biotylated hydroxyanisol (BHA) (200 µM) in α-MEM medium without FBS for 1 day (induction-phase 1). Then, BMSCs were washed with phosphate buffer saline (PBS) and proceeded to the 2nd phase of induction (induction-phase 2), where the induction medium was changed with α-MEM and 15% FBS containing all-trans retinoic acid (RA) (1 µM) (for 3 days).

At the end of the 2nd phase, the cell population of the flasks was harvested for evaluating the mRNA of NeuroD and Oct-4 markers by RT-PCR. Also, immunocytochemical analysis was performed on the adherent cell population.

The isolated and induced BMSCs were plated on a gelatin-coated glass coverslip, washed in PBS and fixed with 4% paraformaldehyde in PBS for 15 minutes. The fixed cells were washed twice with PBS before staining. Permeabilization and blocking nonspecific antigen reaction were carried out in blocking buffer consisting of 0.1% Triton X-100 and 10% goat serum in PBS for 1 hour. The primary antibodies (mouse anti-fibronectin monoclonal antibody diluted at 1:100, mouse anti-nestin polyclonal antibody diluted at, 1:100, mouse anti-NF68 monoclonal antibody diluted at 1:50, mouse anti-NF160 monoclonal antibody diluted at 1:50, and mouse anti-GFAP monoclonal antibody diluted at 1:800 (Sigma)) were incubated overnight at 4ºC temperature and washed three times in PBS. The secondary antibodies (anti-mouse FITC-conjugated (Chemicon, diluted at 1:100)) were used for 2 hours at room temperature. Immunolabeling with a fluorescent nuclear counterstaining (ethidium bromide, diluted at 1:10000) was used to quantify the total cell number. The cells were mounted with gelatin and viewed under a Ziess, Axiophot, Germany microscope, and the images were captured with a CCD camera directly connected to the system. Nuclear counting was done for the isolated and induced BMSCs. The numbers of immunoreactive cells were divided by the total cell number in order to estimate the percentage of immunoreactive cells. Each experiment was replicated at least 5 times so that reproducibility could be insured. For negative controls, the primary antibodies were omitted and the same staining procedure was preceded as above.

The expression of genes in Table 1 was evaluated, using RT-PCR. The total RNA was extracted, using the RNX plus™ kit according to the manufacturer’s recommendations (Cinnagen, Tehran, Iran). Briefly, 1 ml of RNX plus was added to a tube containing 1-2 millions homogenized cells and incubated at room temperature for 5 minutes. Chloroform (200 µl) was added to the solution and centrifuged for 15 minutes at 12 000 g. The upper phase was then transferred to another tube and an equal volume of isopropanol was added. The mixture was centrifuged for 15 minutes at 12 000 g and the resulting pellet was washed in 70% ethanol and dissolved in DEPC-treated water. The purity and the integrity of the extracted RNA were evaluated by optical density measurements and visual observation of sample electrophoresis on 2% agarose gel.

 

 

Table 1: The primers used in the study using reverse transcription polymerase chain reaction (RT-PCR) technique.

Genes

Primer (5′→3′)

bp

Accession No.

Annealing temp.

β2 microglobulin

F: CCGTGATCTTTCTGGTGCTT

R: TTTTGGGCTCCTTCAGAGTG

300

NM-012512

58 °C

Oct-4

F: AAGCTGCTGAAACAGAAGAGG

R: ACACGGTTCTCAATGCTAGTC

285

NM-001009178

57 °C

NeuroD

F: AAGCACCAGATGGCACTGTC

R: CAGGACTTGCATTCGATACAC

215

XM-341822

56 °C

 

 

One microgram of the total RNA was used as a template in a 20 µl volume cDNA synthesis reaction containing 0.5 µg oligodT. This solution was first denaturated at 70 ºC for 5 minutes and chilled on ice immediately. Then, the mixture of 20 U ribonuclease inhibitor, 1 mM dNTPs, the 5x buffer supplied by the manufacturer and the deionized water (nuclease free) up to 19 µl were added and the mixture was incubated at 37 ºC for 5 minutes. Then, 200 U RevertAidTM M-MuLV Reverse Transcriptase (Fermentas Inc.) was added to the reaction and the tube was incubated in a thermocycler (BIO RAD) at 42 ºC for 60 minutes, and at 70 ºC for 10 minutes afterwards. Two negative control reactions, without RNA and without M-MuLV, accompanied each reaction, as well.15

PCR was performed, using 2 µl of synthesized cDNA with 1.25 U Taq polymerase (Cinnagen, Tehran, Iran), 1.5 mM MgCl2, 200 µM dNTPs, 1 µM of each primer, 10x buffer and deionized distilled water in a 50 µl total reaction volume. All common components were added into the master mix and then aliquoted in tubes. The cycling conditions were as follows: initial denaturation at 94 ºC for 5 minutes followed by 35 cycles of  94 ºC for 30 seconds, 56-58 ºC (depending on the primers described in Table 1) for 30 seconds, 72 ºC for 45 seconds, and a final extension of 72 ºC for 5 minutes. Each experiment was repeated at least 3 times in order to ensure reproducibility. The size of the digested products was checked on 2% agarose gel electrophoresis.

All the values were expressed as Mean±SEM. The statistical analysis was carried out, using ANOVA with Tukey's multiple comparison. For each parameter, the significance level was determined, using SPSS software (Version 10, Chicago, IL, USA).

 

 

Results

 

The BMSCs were isolated from rat bone marrow aspirates and propagated in culture. The prepared bone marrow contained a heterogeneous population of cells. The cultures initially grew as a monolayer of flat, polygonal or bipolar cells at low density but assumed a more fibroblast-like morphology when they reached confluency. Many of the cells in the primary cultures of BMSCs contained a small population of phase bright round cells that were lost with subsequent passages.

In order to further define the cellular phenotype in the fourth passage of the BMSCs in culture, we used anti-fibronectin antibody, a stromal marker of BMSCs. We observed that more than 92.75±3.86 % of the cells were fibronectin immunopositive but none or very few of the cells in this stage expressed detectable markers of transdifferentiated neuro-glial cells such as nestin, NF68 and GFAP (Figures 1, 2). In addition, mRNA of Oct-4, a stemness marker, was expressed in these cells13; however, NeuroD (a transcription factor transiently expressed in neuronal precursor cells)16 mRNA was not expressed (Figures 3, 4).

 

 

Fig. 1: (a) shows fibronectin immunostaining of the isolated BMSCs in fourth passage without any induction with anti-fibronectin antibody as a primary antibody followed by the secondary antibody conjugated with FITC, and counter stained with ethidium bromide. The figure represents a qualitative feature of the immunostained cells, (b) shows Phase contrast of (a) picture.

 

 

Fig. 2: The means and the standard error of the percentages of the immunostained cells with different antibodies (fibronectin, nestin, NF68, GFAP) after 4 days of induction in untreated and treated BMSCs (ethidium bromide for counterstaining).

*Indicate statistical-significance between BMSCs and the other experimental groups significancy level P<0.001., † show the statistical significance level between DMSO-RA and the other experimental groups, significancy level P<0.05.

 

 

Fig. 3: RT-PCR analysis of rat BMSCs using Oct-4 primer. An electrophorogram of RT-PCR product of mRNA extracted from induced BMSCs in end of induction stage. The leftmost lane represents the DNA ladder, β2M serves as an internal control and spinal cord as positive control.

 

Fig. 4:An electrophorogram of RT-PCR product of NeuroD mRNA extracted from induced BMSCs in end of induction stage. The rhightmost lane represents the DNA ladder; β2M and spinal cord like Fig 3.

 

 

We showed that treatment of BMSCs with DMSO-RA at the end of the induction stage resulted in mRNA expression of NeuroD and disappearance of Oct-4 as compared with undifferentiated BMSCs, but decreasing expression of NeuroD and disappearance of Oct-4 were observed in βME-RA and BHA-RA combinations, respectively.

The transdifferentiation of the BMSCs into NELCs was evaluated by nestin expression with immunocytochemistry. A significant increase in nestin expression was detected in DMSO-RA, in contrast to βME-RA, BHA-RA and BMSCs (Figures 2, 5). The transdifferentiation of the treated BMSCs into astrocytes was trivial (Figures 1, 2).

 

Fig. 5: Immunostaining by anti-Nestin (a), anti-NF68 (c) and anti-GFAP (e) antibodies and phase contrast (b) , (d) and (f) respectively on treated BMSCs in 4th passage by DMSO-RA, the primary antibodies followed by the secondary antibody conjugated with FITC, and counter stained with ethidium bromide.

 

 

Discussion

 

The results of this investigation showed that when the fourth passage of the BMSCs was grown in the presence of DMSO and was followed by RA, it produced mainly NELCs, which were immunoreactive to nestin. This combination (DMSO-RA) showed a significantly higher percentage of NELCs than other inducers (βME-RA and BHA-RA).

Several recent in-vivo and in-vitro studies suggested that BMSCs might be capable of generating into either neurons or glia.8,16-18 In this study, BMSCs were induced to differentiate into cells with a neuroepithelial phenotype, using three different protocols. All of the treatment protocols led to a neuroepithelial phenotype in a similar pattern with significant differences. Indeed, at the end of all the treatments, BMSCs expressed neuroepithelial, neuronal and glial markers such as nestin, NF68 and GFAP.

Deng et al. found that human BMSCs could be differentiated into early neural progenitors by increasing intracellular cAMP. One of our inducers was BHA, which was reported to increase intracellular cAMP, as well.19 Since it has been suggested that BME and DMSO are capable of supporting the viability and differentiation of fetal mouse brain neurons,20 we used these chemicals in the first phase of induction followed by RA, a derivative of vitamin A. This is essential in maintaining normal cellular growth and development. In fact, RA receptors are present in various tissues of both embryonic and adult animals, in particular, in the nervous system,21,22 where they promote neuronal differentiation.23 Previous studies  demonstrated that RA induced a great number of neurites as well as increased neurite length in cultured neurons.24 It was used in combination with other factors in order to induce differentiation of BMSC into neural cells.13,25

The results of undifferentiated BMSCs in-vitro illustrated immunoreactivity for nestin (1%) and NF68 (1%) in very low detectable levels while GFAP was not expressed (Figures 1, 2); these results are confirmed by expressing nestin, NF160, and GFAP in detectable levels by human MSCs in culture.26 Also Bossolasco et al. interpreted that human mesenchymal stem cells (MSCs) were expressing neural progenitor, neuronal cell, or astro-glial cells mRNAs in culture. This may indicate that MSCs seemed to already contain a subpopulation of cells capable of neuro-glial differentiation.26 Other investigators reported that untreated rat MSCs expressed neuro-glial specific markers and showed neuro-glial differentiation potential.8,27 In fact, the constitutive expression of these proteins by BMSCs confirms the hypothesis that these cells are "multipotential" and, thus, can retain the ability for neuronal differentiation.27

The expression of Oct-4 gene, a stem cell marker,28 was detected by RT-PCR in undifferentiated BMSCs and downregulated in induced BMSCs. Other investigators confirmed these findings that Oct-4 expressed in bone marrow of rhesus macaques,29 mice embryonic stem and germ cells, but it was suppressed in the differentiated ESCs30 and NSCs.31

Bossolasco and Seung et al. found no detectable level of NeuroD in undifferentiated BMSCs.26,32 This is consistent with the findings of this investigation. However, Woodbury et al. showed that NeuroD gene expression in BMSCs and in marrow SCs was very low.27 NeruroD gene was detected at the end of the induction by DMSO-RA more than the other groups. Also, Sanchez-Ramos et al. reported the expression of this gene in the presence of RA and BDNF in BMSCs.8 This study shows that DMSO and RA are capable of generating high levels of NELCs and low levels of glial cells in treated BMSCs in order to provide cellular reservoir for some neurodegenerative disorders of the central nervous system.

 

 

Acknowledgment

 

This work was supported by Neuroscience Center of Khatam-Al- Anbia hospital, Tehran, Iran.

 

Conflict of interest: None declared.

References: (32)

  1. Bjartmar C, Yin X, Trapp BD. Axonal pathology in myelin disorders. J Neurocytol 1999;28:383-95. [10739578] [doi:10.1023/A:1007010205037]
  2. Ramalho-Santos M, Yoon S, Matsuzaki Y, Mulligan RC, Melton DA. "Stemness": transcriptional profiling of embryonic and adult stem cells. Science 2002;298:597-600. [12228720] [doi:10.1126/science.1072530]
  3. Joshi C, Enver T. Molecular complexities of stem cells. Curr Opin Hematol 2003;10:220-8. [12690290] [doi:10.1097/00062752-200305000-00005]
  4. Petersen BE, Bowen WC, Patrene KD, Mars WM, Sullivan AK, Murase N, Boggs SS, Greenberger JS, Goff JP. Bone marrow as a potential source of hepatic oval cells. Science 1999; 284:1168-70. [10325227] [doi:10.1126/science.284.5417.1168]
  5. Ferrari G, Cusella-De Angelis G, Coletta M, Paolucci E, Stornaiuolo A, Cossu G, Mavilio F. Muscle regeneration by bone marrow-derived myogenic progenitors. Science 1998;279:1528-30. [9488650] [doi:10.1126/science.279.5356.1528]
  6. Orlic D, Kajstura J, Chimenti S, Jakoniuk I, Anderson SM, Li B, Pickel J, McKay R, Nadal-Ginard B, Bodine DM, Leri A, Anversa P. Bone marrow cells regenerate infarcted myocardium. Nature 2001;410:701-5. [11287958] [doi:10.1038/35070587]
  7. Deng YB, Liu XG, Liu ZG, Liu XL, Liu Y, Zhou GQ. Implantation of BM mesenchymal stem cells into injured spinal cord elicits de novo neurogenesis and functional recovery: evidence from a study in rhesus monkeys. Cytotherapy 2006;8:210-4. [16793730] [doi:10.1080/14653240600760808]
  8. Sanchez-Ramos J, Song S, Cardozo-Pelaez F, Hazzi C, Stedeford T, Willing A, Freeman TB, Saporta S, Janssen W, Patel N, Cooper DR, Sanberg PR. Adult bone marrow stromal cells differentiate into neural cells in vitro. Exp Neurol 2000;164:247-56. [10915564] [doi:10.1006/exnr.2000.7389]
  9. Moore BE, Quesenberry PJ. The adult hemopoietic stem cell plasticity debate: idols vs new paradigms. Leukemia 2003;17:1205-10. [12835714] [doi:10.1038/sj.leu.2402956]
  10. Svendsen CN, Langston JW. tem cells for Parkinson disease and ALS: replacement or protection? Nat Med 2004;10:224-5. [14991036] [doi:10.1038/nm0304-224]
  11. Gage FH. Mammalian neural stem cells. Science 2000;287:1433-8. [10688783] [doi:10.1126/science.287.5457.1433]
  12. Woodbury D, Schwarz EJ, Prockop DJ, Black IB. Adult rat and human bone marrow stromal cells differentiate into neurons. J Neurosci Res 2000;61:364-70. [10931522] [doi: 10.1002/1097-4547(20000815)61:4<364::AID-JNR2>3.0.CO;2-C]
  13. Lamoury FM, Croitoru-Lamoury J, Brew BJ. Undifferentiated mouse mesenchymal stem cells spontaneously express neural and stem cell markers Oct-4 and Rex-1. Cytotherapy 2006;8:228-42. [16793732] [doi:10.1080/14653240600735875]
  14. Silani V, Cova L, Corbo M, Ciammola A, Polli E. Stem-cell therapy for amyotrophic lateral sclerosis. Lancet 2004;364:200-2. [15246734] [doi:10.1016/S0140-6736(04)16634-8]
  15. Keirstead HS, Nistor G, Bernal G, Totoiu M, Cloutier F, Sharp K, Steward O. Human embryonic stem cell-derived oligodendrocyte progenitor cell transplants remyelinate and restore locomotion after spinal cord injury. J Neurosci 2005;25:4694-705. [15888645] [doi:10.1523/JNEUROSCI.0311-05.2005]
  16. Kim BJ, Seo JH, Bubien JK, Oh YS. Differentiation of adult bone marrow stem cells into neuroprogenitor cells in vitro. Neuroreport 2002;13:1185-8. [12151766] [doi:10.1097/00001756-200207020-00023]
  17. Mezey E, Chandross KJ, Harta G, Maki RA, McKercher SR. Turning blood into brain: cells bearing neuronal antigens generated in vivo from bone marrow. Science 2000;290:1779-82. [11099419] [doi:10.1126/science.290.5497.1779]
  18. Brazelton TR, Rossi FM, Keshet GI, Blau HM. From marrow to brain: expression of neuronal phenotypes in adult mice. Science 2000;290:1775-9. [11099418] [doi:10.1126/science.290.5497.1775]
  19. Deng W, Obrocka M, Fisher I, Prockop DJ. In vitro differentiation of human marrow stromal cells into early progenitors of neural cells by conditions that increase intracellular cyclic AMP. Biochem Biophys Res Commun 2000;282:148-52. [11263984] [doi:10.1006/bbrc.2001.4570]
  20. Ishii K, Katayama M, Hori K, Yodoi J, Nakanishi T. Effects of 2-mercaptoethanol on survival and differentiation of fetal mouse brain neurons cultured in vitro. Neurosci lett 1993;163:159-62. [8309623] [doi:10.1016/0304-3940(93)90371-Q]
  21. Wagner M, Han B, Jessell TM. Regional differences in retinoid release from embryonic neural tissue detected by an in vitro reporter assay. Development 1992;116:55-66. [1483395]
  22. Maden M, Sonneveld E, van der Saag PT, Gale E. The distribution of endogenous retinoic acid in the chick embryo: implications for developmental mechanisms. Development 1998;125:4133-44. [9753668]
  23. Takahashi J, Palmer TD, Gage FH. Retinoic acid and neurotrophins collaborate to regulate neurogenesis in adult-derived neural stem cell cultures. J Neurobiol 1999;38:65-81. [10027563] [doi:10.1002/(SICI)1097-4695(199901)38:1<65::AID-NEU5>3.0.CO;2-Q]
  24. Maden M. Role and distribution of retinoic acid during CNS development. Int Rev Cytol 2001; 209:1-77. [11580199] [doi:10.1016/S0074-7696(01)09010-6]
  25. Locatelli F, Corti S, Donadoni C, Guglieri M, Capra F, Strazzer S, Salani S, Del Bo R, Fortunato F, Bordoni A, Comi GP. Neuronal differentiation of murine bone marrow Thy-1- and Sca-1-positive cells. J Hematother Stem Cell Res 2003;12:727-34. [14977481] [doi:10.1089/15258160360732740]
  26. Bossolasco P, Cova L, Calzarossa C, Rimoldi SG, Borsotti C, Deliliers GL, Silani V, Soligo D, Polli E. Neuro-glial differentiation of human bone marrow stem cells in vitro. Exp Neurol 2005;193:312-25. [15869934] [doi:10.1016/j.expneurol.2004.12.013]
  27. Woodbury D, Reynolds K, Black IB. Adult bone marrow stromal stem cells express germline, ectodermal, endodermal, and mesodermal genes prior to neurogenesis. J Neurosci Res 2002;69: 908-17. [1220 5683] [doi:10.1002/jnr.10365]
  28. Andrews PW. Retinoic acid induces neuronal differentiation of cloned human embryonal carcinoma cell line in vitro. Dev Biol 1984;103:285-93. [6144603] [doi:10.1016/0012-1606(84)90316-6]
  29. Izadpanah R, Joswig T, Tsien F, Dufour J, Kirijan JC, Bunnell BA. Characterization of multipotent mesenchymal stem cells from the bone marrow of rhesus macaques. Stem Cells Dev 2005;14:440-51. [16137233] [doi:10.1089/scd.2005.14.440]
  30. Navarro-Alvarez N, Soto-Gutierrez A, Yuasa T, Yamatsuji T, Shirakawa Y, Nagasaka T, Sun SD, Javed MS, Tanaka N, Kobayashi N. Long-term culture of Japanese human embryonic stem cells in feeder-free conditions. Cell Transplant 2008;17:27-33. [18468232] [doi:10.3727/000000008783906900]
  31. Davis SF, Hood J, Thomas A, Bunnell BA. Isolation of adult rhesus neural stem and progenitor cells and differentiation into immature oligodendrocytes. Stem Cells Dev 2006;15:191-9. [16646665] [doi:10.1089/scd.2006.15.191]
  32. Seung Yeu MD, Hyung –Jinlee MD, Jin Seok Yi. The survival and migration pattern of the Bone marrow stromal cells after intracevebral transplantation in Rats. J korean Neurosurg 2004;36:400-4.